The sequence 5' GCCTAATGCGTTCATAATGGCGTTTGCCACGGACGTAAAGTCGT 3' represents 50% of a PCR product which is cloned into a 1.5 kb plasmid for bacterial expression.  What would the agarose gel look like, including a lane for markers, and where would the following pieces of DNA run: 1. the PCR insert 2. the empty uncut plasmid 3. the empty plasmid cut with a single restriction enzyme 4. the cloned plasmid containing the insert

Q: Your company has decided to develop a PCR test that will be used to determine Huntington's disease.…

A: The polymerase chain reaction (PCR), is one of the most useful molecular biology techniques used to…

Q: Given below is the DNA template. What are the gene products? 3’ TACCGGCCTATCTAGGGCCATGGCTTAATTCCC 5’…

A: DNA is the sequence of Nucleotides that are transcribed into mRNA during transcription. Once DNA is…

Q: The target sequence for a PCR amplification is shown below. When the final cycle of PCR has ended,…

A: The polymerase chain reaction (PCR), often known as "molecular photocopying," is a rapid and…

Q: Suppose that you would like to amplify the DNA sequence below by a PCR reaction. Design 8 nucleotide…

A: Primer is a shory stretch of nucleotides which binds to 3' end of template DNA. It provides free OH…

Q: You are trying to clone a gene, You have successfully isolated it from the genomic DNA of an…

A: The term DNA cloning is associated with a process that plays an important role in making copies of a…

Q: 1) You would like to clone a gene by PCR. The sequence of the two ends of the coding strand for the…

A: A laboratory technique for amplifying DNA sequences is polymerase chain reaction (PCR). The approach…

Q: You would like to amplify the gene shown here using PCR.  Assume the primer to the 5' end of the…

A: PCR stands for Polymerase Chain Reaction. This is used to amplify the gene of interest.

Q: You have a 5.3 kb PstI fragment cloned into the PstI site of the vector PUC19, which is 2.7 kb in…

A: In recombinant DNA technology, cloning is a technique that is used to generate identical copies of…

Q: You want to clone a specific PCR amplicon. You have determined that the amplicon you want to clone…

A: Restriction enzymes are endonucleases derived from bacterial cells that cleave DNA (deoxyribonucleic…

Q: Which of the following would you need to clone a human gene? Choose all that apply a) A surrogate…

A: J. B. S. Haldane was the first to discover the clue of human cloning, for which he used the terms…

Q: Following a dye terminator DNA sequencing reaction using 2',3'-dideoxynucleotide triphosphates…

A: Dye terminator DNA sequencing is the modern version of Sanger sequencing. It uses…

Q: If the size of the of a pDrive cloning vector is 3,850 bp and a mecA PCR product is inserted into…

A: Genetic engineering (GE) is the intentional change of an organism's genetic structure, which…

Q: To verify the is indeed inside your plasmid, you'd like to do a colony PCR. But you need primers for…

A: introduction you can confirm the presence of gene within the vector by two ways either by…

Q: Why is it important to sequence positive clones derived from PCR cloning? Group of answer choices

A: PCR is a technique of amplification of a given molecule of DNA to increase its copy number.

Q: Your cloning vector has restriction recognition sites for two restriction endonucleases, EcorI and…

A: Introduction Recombinant DNA technology enables us to construct DNA using the Recombination method.…

Q: Select two primers from the list below such that your selected primers create a pair capable of…

A: Primer is a short strand of nucleotide sequence which helps in synthesis of DNA. After the…

Q: sequence shown below is the 5' to 3' strand of a dsDNA template. You are asked to design PCR primers…

A: The polymerase chain reaction (PCR) is a laboratory (in vitro) technique for generating large…

Q: A gel pattern displaying PCR products shows four strong bands. The four pieces of DNA have lengths…

A: The polymerase chain reaction is a molecular biological technique responsible for exponentially…

Q: Tell me how did you prepared the gel if the tray is 150 ml? how many milliliters of the TBE and how…

A: The answer to the first question is, 3 grams of agarose in 150 ml of TBE.   *to get the second…

Q: .How much PCR product (500 bp) should be added to a ligation in which 50 ng of Vector (6.6 kb)…

A: Introduction :- Polymerase chain reaction (PCR) is a widely used method for rapidly producing…

Q: Examine the sequence for the DNA fragment below. Your job is to design primers for PCR that would be…

A: A primer may be a brief single-stranded nucleic acid utilized by all living living beings within the…

Q: You have two PCR primers: Forward- 5' TGAGCTAGGC 3' and Reverse- 5' GGTTCAGTCAG 3'. Show the binding…

A:

Q: A newly discovered insect has a genomic DNA that does not contain any repetitive DNA or any intronic…

A:

Q: You performed RADseq analysis of two genomes using the restriction enzyme EcoRI. From each genome,…

A: * Restriction site associated DNA (RAD) markers are genetic marker that are used for association…

Q: Suppose you have to design two PCR primers, 16 bases in length, to amplify the whole of the 100 bp…

A: Primers are short nucleic acid molecule, that are single stranded in nature and area prerequisite…

Q: You are trying to study the effects of Drug A on the expression of Gene X in a tumor sample (lane…

A: Reverse transcription enzyme chain reaction (RT-PCR) may be a variation of normal PCR that involves…

Q: You amplify the DNA sample shown with the indicated primers. Highlight in yellow the region that…

A:

Q: Which of the following would you need to clone a goat? Choose all that apply a) A restriction…

A: For clonnig a DNA we will use the recombinant DNA technology which will require the  , Donar…

Q: You are asked to design PCR primers (18 nucleotides) to amplify the coding region (without the stop…

A: If you cloned your DNA of interest between the BamHI and EcoRI sites, you could sequence using the…

Q: let three loci be X,Y,Z. three pairs of primes can be used to amplify these loci in multiplex PCR.

A: STR are Short Tandem Repeats. These are the set of a few nucleotides which repeat themselves in a…

Q: In the very first round of PCR using genomic DNA, the DNA primers prime synthesis that terminates…

A: It is a rapid and versatile in vitro molecular biology technique that is used for the amplification…

Q: The restricition EcoRI cleaves double-stranded DNA at the sequence 5'-GAATTC-3' the restriction…

A: The restriction enzymes cuts specific sequence on double stranded DNA molecule and they are used in…

Q: If you are a genetic engineer and you cloned your gene of interest in a plasmid and you want to know…

A: Answer. Blotting describes the immobilization of sample nucleic acids/proteins onto a solid support.…

Q: You want to set up 50 µl total volume of a PCR reaction. You have a microfuge tube of Forward primer…

A: Polymerase chain reaction (PCR) is a widely used method for rapidly producing millions to billions…

Q: Below are gel electrophoresis results for initial and nested PCR of the Shrimp Plant. Use the…

A: Electrophoresis is the process of separation of molecules on the basis of their charge/mass ratio…

Q: A newly discovered insect has a genomic DNA that does not contain any repetitive DNA or any intronic…

A: Biotechnology is the use of our understanding of biological processes to develop useful applications…

Q: For the given restriction enzyme: BslI (CCNNNNN^NNGG)  i) Approximately how many fragments would…

A: Restriction endonucleases are enzymes that does cleavage of DNA at specific sites. These specific…

Q: You have two samples you have to sequence: one is a cloned plasmid that you want to verify the…

A: Sequencing of DNA refers to the biochemical methods for determining the order of the nucleotide…

Q: What are the key modifications to the PCR primers, SHFw1 and SHRv1 in order for you to clone the PCR…

A: "Biotechnology" is the use of our knowledge of biological processes to the development of beneficial…

Q: The exponential nature of PCR allows spectacular increases in the abundanceof a DNA sequence being…

A: Polymerase chain reaction, or PCR, is a technique to make many copies of a specific DNA region in…

Q: The sequence below shows 140bp of a double-stranded DNA sequence coding for histone H2A. What two…

A: PCR or polymerase chain reaction is a rapid and versatile in vitro technique for amplification of…

Q: You want to make a recombinant DNA in which aPCR product amplified from the human genome is inserted…

A: PCR (polymerase chain reaction) is a technique mostly used in molecular biology to make millions to…

Q: You are trying to clone a gene. You have successfully isolated it from the genomic DNA of an…

A: Gene cloning is a process to form multiple copies of desired DNA of interest.  This is done to- * to…

Q: A small DNA molecule was cleaved with several different restriction nucle- ases, and the size of…

A: Introduction: DNA is a type of nucleic acid that is present in the nucleus of the cell. It is the…

Q: The total size of the plasmid is 2686 bp. There is a PstI recognition site at position 439, HindIII…

A: Answer - d. 3 fragments: 447bp, 507bp and 1732bp

Q: We usually think of enzymes as being most active at around 37°C, yet in PCR the DNA polymerase is…

A: PCR, like DNA replication in an organism, necessitates the use of a DNA polymerase enzyme to create…

Q: Suppose you were interested in generating a PCR amplicon including the bracketed sequence below.…

A: PCR or Polymerase Chain Reaction is a specialized type of method which is used to obtain copies of…

Q: PCR errors during library amplification are one possible source of false positive results. If an…

A: PCR is a polymerase chain reaction. This is a biotechnology used to amplify the DNA copies.