The sequence of a polypeptide is determined by the order of codons that specifythe amino acids in the polypeptide. How many different sequences of codons canspecify the polypeptide sequence methionine-histidine-lysine? (Use the table tofind the number of possibilities.)SECOND BASEUAUUACFTyrosine (Tyr)UAA -Stop codonUAG -Stop codonUUULUGUCysteine (Cys)UCUucUCA FSerine (Ser)ucaUucPhenylalanine (Phe)UUAL Leucine (Leu)CAUCACCAA Glutamine (Gin)CAGFUGA -Stop codonuaa -Tryptophan (Trp)CGUсосCGA FArginine (Arg)CUCUHistidine (His)CuA FLeucine (Leu)Cua)Proline (Pro)CCAccaAAU Asparagine (Asn)AGU Serine (Ser)AGCAUUACUACCThreonine (Thr)AACFAAAAAGLysine (Lys)AUC Fisoleucine (lle)AUAMethionine (Met)AUG -Start codonACAACGAGAAGGFArginine (Arg)GUGACAspartic acid (Asp)GGAGAA Glutamic acid (Glu) Gaa)GcU-Valine (Val)G GUAGCA FAlanine (Ala)Glycine (Gly)8.14THIRD BASE2.FIRST BASE

Proteins are the ultimate products of the genes. DNA is transcribed into m RNA and this is…

The sequence of a polypeptide is determined by the order of codons that specify the amino acids in the polypeptide. How many different sequences of codons can specify the polypeptide sequence methionine-histidine-lysine? (Use the table to fınd the number of possibilities.) SECOND BASE UCU ucc Serine (Ser) UUUL UGU UAU UAC Tyrosine (Tyr) UAA -Stop codon UAG -Stop codon Cysteine (Cys) UGA -Stop codon uGa -Tryptophan (Trp) Phenylalanine (Phe) Uuc UUAL Leucine (Leu) Uua UCA uca CU Cuc CUA FLeucine (Leu) Cu CAU CAC - Histidine (His) CCA Proline (Pro) ca CAA CAGGlutamine (Gin) cac CGA FArginine (Arg) cua AUU AUC Fisoleucine (le) AAU AAC AGU AGCSerine (Ser) Asparagine (Asn) ACA Threonine (Thr) ACG AAA AAGFLysine (Lys) AUA Methionine (Met) AUG Start codon AGGArginine (Arg) GUU) GUC QuA Valine (Val) GUG) GCU acC - Alanine (Ala) GGU GAAspartic acid (Asp) aac Giycine (Gly) GCA GAAL GGA GAG Glutamic acid (Glu) Gaa) 8 1 4 THIRD BASE FIRST BASE

The sequence of a polypeptide is determined by the order of codons that specify the amino acids in the polypeptide. How many different sequences of codons can specify the polypeptide sequence methionine-histidine-lysine? (Use the table to fınd the number of possibilities.) SECOND BASE UCU ucc Serine (Ser) UUUL UGU UAU UAC Tyrosine (Tyr) UAA -Stop codon UAG -Stop codon Cysteine (Cys) UGA -Stop codon uGa -Tryptophan (Trp) Phenylalanine (Phe) Uuc UUAL Leucine (Leu) Uua UCA uca CU Cuc CUA FLeucine (Leu) Cu CAU CAC - Histidine (His) CCA Proline (Pro) ca CAA CAGGlutamine (Gin) cac CGA FArginine (Arg) cua AUU AUC Fisoleucine (le) AAU AAC AGU AGCSerine (Ser) Asparagine (Asn) ACA Threonine (Thr) ACG AAA AAGFLysine (Lys) AUA Methionine (Met) AUG Start codon AGGArginine (Arg) GUU) GUC QuA Valine (Val) GUG) GCU acC - Alanine (Ala) GGU GAAspartic acid (Asp) aac Giycine (Gly) GCA GAAL GGA GAG Glutamic acid (Glu) Gaa) 8 1 4 THIRD BASE FIRST BASE

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 1VQ

See similar textbooks

Similar questions

If the sequence of amino acids encoded by a strand of DNA is serine-alanine-lysine-leucine, what is the order of bases in the sense strand of DNA? Use the codon chart below to help you: second letter A G UAU Tyr UGU UUU UCU Phe Сys UUC UCC UAC UGC Ser UAA stop |UGA stop | A UAG stop UGG Trp UUA UCA UUG Leu G UCG CUU CCU CAU CGU His CUC ССС САС CGC Leu Pro Arg CUA ССА САА CGA Gln CUG CCG CAG CGG AUU ACU AAU AGU Asn Ser AUC le A AUA AAC AAA AGC AGA Arg АСС Thr ACA AUG Met | ACG AAG Lys AGG GUU GCU GAU GGU Asp GUC Val GUA GAC S GAA Glu GCC GGC Gly GGA Ala GCA GUG J GCG GAG GGG) O 3' AGACGTTTCAAT 5' O 3' UGUGCAAAGUUA 5' О 5 TGTGCTTТCТТА 3' first letter UCAG UCAG PCAG third letter
Given the following codons and their corresponding amino acids: UUU-Phenylalanine GAA- Glutamate CAA- Glutamine AAU- Asparagine AAC- Asn AAA- Lysine UCU- Serine GGA-Glycine ACC-Threonine AUG- Met/ START codon CCU- Proline GUU- Valine UAU-Tyrosine UAA- STOP AGG- Arginine AUU- Isoleucine CAU- Histidine GCU- Alanine UGU-Cysteir GAU-Asparti CUA-Leucine UGG-Tryptol CGU-Arginin Box 1: Show the mRNA sequence which codes for the short peptide, lys-ala-phe- leu. Include what should come before and after this short message. Don't leave any spaces between the letters. Box 2: Show the tRNA anticodon sequence that would line up with the mRNA strand from Box 1. Don't leave any spaces between the letters. Box 3 & 4: Show the DNA base sequence that would be found in the DNA double helix which carries the gene for this peptide. Give the coding strand sequence in Box 3 and template strand sequence in Box 4. Don't leave any spaces between the letters. Box 5: What if there was a frameshift at leucine…
Codons in the set CUU, CUC, CUA, and CUG all code for the amino acid leucine. In this set, the first and second bases are identical; the identity of the third base is irrelevant. For what other sets of codons is the third base also irrelevant? For what amino acid(s) does each set code?
Use the codon chart to determine the following RNA strand in amino acids (Remember to write it the same way the strand is): ACA-AGG-UUA-UGA second letter C A UAU Tyr U UUU UCU UGU Phe Cys UUC UCC UAC UGC C Ser UAA stop | UGA stop| A UAG stop UGG Trp UUA UCA UUG Le UCG CUU CCU CAU CGU His CUC ССС CAC CGC Leu Pro Arg CUA ССА САА CGA Gln СCG CAG CGG CUG AGU AAU Asn AUU ACU Ser AGC S AGA Arg AAC AUC } lle A AUA АСC Thr AAA Lys АСА AUG Met ACG AAG AGG GUU GCU GAU GGU Asp GAC GGC Gly GGA GCC GUC Val Ala GAA GAG } GUA GCA Glu GGG GUG GCG Your answer first letter ACUCAGUCAGUCAG third letter
Part of a sequence of DNA from a person without this genetic disease is: TAG TAA AAA CCA CCC AGG Part of a sequence of DNA from a person with a genetic disease is: TAG TAA CCA CCC AGG The possible codons for some amino acids are shown in the table. Amino acid Codons glycine GGU GGC GGA GGG isoleucine AUU AUC phenylalanine UUU UUC serine UCU UCC UCA UCG Which amino acid is missing from a person with this genetic disease? serine glycine O phenylalanine isoleucine
Using the codon table, identify a 5’-3’ sequence of nucleotides in the dna template strand for mRna coding for the polypeptide sequence NH2-PHe-Pro-lys-COOH.
Second letter C A UUU Phenyl- UUC alanine UCU UCC UAU UAC UGU UGC Tyrosine Cysteine Serine UCA UCG UAA Stop codon UAG Stop codon UGA Stop codon UGG Tryptophan UUA A Leucine UUG CCU ССС CAU CAC CUU CGU CGC Histidine C CUC C CUA Leucine Proline Arginine CCA СCG CGA CGG A CAA CAG CUG Glutamine AGU AGC AUU AAU ААС ACU Asparagine Serine AUC Isoleucine A AUA ACC АСА Threonine AAA AGA Methionine; start codon ACG Lysine Arginine AUG AAG AGG U GUU GUC GUA GCU GCC GCA GAU Aspartic GAC acid GGU GGC GGA GGG Valine Alanine Glycine GAA Glutamic GAG acid GUG GCG G Given the codon UCA in the first exon of a gene, which change is most likely to result in a nonsense mutation? A transversion of A to U Change of nucleotide in the third position Change of nucleotide in the first position A transition of A to G Change of nucleotide in the second position First letter Third letter
For the m-RNA nucleotide codons given below, what is the corresponding sequence of amino acids? AUG UGU AUA UAU GUA AUC ACC UUC UAU GUA ACA UUU UGG AAC AGC UGC CAU GUA UAC CAG AAA CUU GCA GAG CUG GCU UUG AUA UGA The α-helices are known to contain primarily the amino acids methionine, alanine, leucine, glutamate, and lysine, while β-pleated sheets are known to primarily contain the amino acids tryptophan, tyrosine, phenylalanine, isoleucine, valine, and threonine. Which one of these two types of secondary protein structure is present with this amino acid sequence?
What amino acid sequence will be generated, based on the following DNA codon sequence? Did you read this question carefully also? Are you certain? (You may list the three letter abbreviations for the amino acids listed below) DNA Sequence: TAC AAG CCC TAG GCG ATA АТС [a] Table 1. MRNA codons & associated amino acids Second base C G UUU Phe UUC UCU UAU UGU U Тyr UAC Cys UGC UCC Ser UCA UAA Stop UGA Stop A UUA Leu UUG UCG UAG Stop UGG Trp G CUU CCU CAU] His CAC CGU CUC C CUA CGC Leu Pro CCA Arg CGA CAA Gin CUG CCG CAG CGG AUU ACU AAU Asn AAC Thr AAA Lys AAG AGU Ser AGC AUC Ile ACC AUA AGA Arg AGG ACA AUG Met or start ACG GUU GCU GAU GGU Asp GAC U GÚC GCC Ala GCA GGC Val GUA Gly GAA GGA Glu GAG GUG GCG GGG G Cooriaht O Pearson Education. Inc Dublishina as Beniamin Cumminas First base (5' end) Third base (3' end)
The chart can be used to determine the amino acid that a specific codon encodes. Finl Second Letter Thind Letter U с A G phenylalanine serine tyrosine cysteine U phenylalanine serine U tyrosine cysteine с leucine serine stop stop A leucine serine slop tryptophan G leucine proline histidine arginine U leucine proline histidine arginine с leucine proline glutamine arginine A leucine proline glutamine arginine G isoleucine threonine asparagine serine U isoleucine threonine asparagine serine C isol cine threonine arginine A (start) lysine lysine threonine arginine G valine alanine aspartate glycine U valine alanine aspartate glycine C valine alanine glutamate olycine A valine alanine glutamate glycine G If a strand of DNA had the sequence GACTTC, then mutated to be GACATC, what sequence of amino acids would be formed? Aspartate and phenyalanine become apartate and isoleucine Leucine and lysine become leucine and tyrosine Aspartate and phenyalanine become aspartate and methionine Leucine…
Give the amino acid sequence with some little explanation please. 5′ –GUACUAAGGAGGUUGUAUGGGUUAGGGG ACAUCAUUUUGA–3′
DNA molecules consist of chemically linked sequences of the bases adenine, guanine, cytosine, and thymine, denoted A, G, C, and T. A sequence of three basesiscalleda codon. A base may appear more than once in a codon. a) How many different codons are there? b) The bases A and G are purines, while C and T are pyrimidines. How many codons are there whose first and third bases are purines and whose second base is a pyrimidine? c) How many codons consist of three different bases?