The size of a DNA fragment that can be inserted into an unmodified λ vector is very limited. Large segment in the central region of the λ DNA molecule can be removed without affecting the ability of the phage to infect Escherichia coli cells. However, the deletion of this non- essential region does affect the life cycle of the bacteriophage. Explain this statement.
Q: )One girl in every two has brown hair. One girl in every three has dimples. What is the probability…
A: A: Probability of 1 girl in every 2 having brown hair is 1/2.B: Probability of one girl in every…
Q: During PCR, the reaction mixture cycles through three temperatures (for example 94, 60, and 72…
A: Introduction : Using the thermo-resistant DNA polymerase, the polymerase chain reaction, also known…
Q: When a cell uses fats for aerobic cellular respiration, it first hydrolyzes (breaks down) fats to…
A: Introduction :- The process of cellular respiration that occurs in the presence of oxygen gas in…
Q: Genetic drift: is variation in the relative frequency of different genotypes in a small population,…
A: Genetic drift It is mechanism of evolution, responsible for random changes in the gene pool. It…
Q: There are several lines of evidence that suggest that chloroplasts and mitochondria were once…
A: For performing independent life, energy production is very much important. Some organisms depend on…
Q: What is the multi hit approch/hypothesis to adencinocama colonrecal cancer. explain and analyse the…
A: The multi-hit hypothesis identifies the combination of genes with mutations that may represent the…
Q: 7.18 In Drosophila, the genes st (scarlet eyes), ss (spineless bris- tles), and e (ebony body) are…
A: Introduction :- any alteration to a cell's DNA sequence. Mutations may result from errors made…
Q: Please explain why cell division is needed and important?
A: Introduction: Cell division is a biological process during which a cell divides to produce…
Q: Which of the following components found in the bone matrix make bone somewhat flexible and…
A:
Q: M13 is a filamentous phage that infects the bacterium Escherichia coli. Infection with M13 is not…
A: A vector is a living organism that transmits an infectious agent from an infected animal to another…
Q: Do environmental stochasticity and demographic stochasticity impact small populations or large…
A: The difference between the actual number of people and the number predicted based on average vital…
Q: @ Explain or describe how homeostasis is the mantenance of a dynamic range of environmental…
A: Homeostasis is the process in which the body changes adjusts to the change in the environmental…
Q: Determine if prophase I of meiosis contains 2 chromatids or only one chromatid.
A: Meiosis Meiosis is sometimes called the reductive cell division. In meiosis, dna replication is…
Q: Tabulate the characteristics differentiating pathogenic Treponema, Borrelia, and Leptospira.
A: Topic Treponema Borrelia Leptospira Family Spirochaetaceae Spirochaetaceae Leptospiracea Disease…
Q: Consider the following scenario: Molecule X is highly concentrated outside of a cell membrane.…
A: The transportation of molecules across the plasma membrane depends on their concentration gradient…
Q: What signals an mRNA for transport
A: mRNA is the specific type of messenger RNA which is single stranded . These mrna gets involve in…
Q: Deletion of these two genes resulted in the expression of multiple VSG's simultaneously. a.
A: Trypanosomes Deletion of these two genes resulted in the expression of multiple VSG's…
Q: F. How much of a 100 mg/mL stock of Ampicillin would you need to add to 400 mL for a 100 ug/mL final…
A: Given data:- Concentration of stock of ampicillin = C1 100mg/ml. Volume of stock solution required…
Q: Why doesn't the blind spot interfere with our normal vision?
A: Our eyes are sense organs for vision. They also help in perception of colour. Human beings have two…
Q: Compare and contrast the types of diabetes mellitus.
A: Introduction :- Most kinds of diabetes lack a known precise cause. Sugar builds up in the…
Q: Ecological impact for land cover ,
A: The land cover is the surface components of a land. Examination of land cover is important for…
Q: GENETICALLY MODIFIED CROP: mRNA 5' tRNA nucleus O Į CAGTTAATGGAGCGATGCCTGGATGGAGAAATCAATTAG nucleus…
A: The genetic code is a set of instructions that enable live cells to produce proteins using genetic…
Q: A polyhistidine-tag or better known by its trademarked name His-tag is an amino acid motif present…
A: In vectors used to produce recombinant proteins, the DNA sequence defining a string of six to nine…
Q: Macmillan Learning An extensive study of a hominid fossil dating from approximately 2 million years…
A: The fossil record of hominids is one of the finest known and most comprehensive of any animal. This…
Q: Discuss the major aetiologies, laboratory findings, and pathologic consequences in a patient with…
A: Congenital heart disease represent the various types of birth defects that causes abnormalities of…
Q: missing a name or two from the list (Enterobacter aerogenes), and (Serratia rubidaea) - should be 20…
A: Bacteria are identified using various biochemical tests and standing techniques. The best example is…
Q: Oldfield mice that live on beaches of the gulf and Atlantic coast of Florida tend to white, wherease…
A: The oldfield mouse or the beach mouse is a nocturnal species of rodent in the family Cricetidae.…
Q: How is anaphase of mitosis different from anaphase I of meiosis?
A: Introduction :- The fourth stage of mitosis, known as anaphase, divides the duplicated genetic…
Q: True or false ? Reactions in our cells happen in a perfect way, therefore DNA replication is error…
A:
Q: The diagrams represent four possible phylogenetic relationship between the four species: M, L, S,…
A: The phylogenetic tree represents the evolutionary relationship between taxons in the phylogeny. It…
Q: what is the reason for an individual to have fasting high HDL levels. list and explain reasons.…
A: Introduction:- HDL ( High Density Lipoproteins) is an essential and good form of the cholestrol…
Q: ing statements about promoters that are true. A promoter specifies where RNA polymerase initiates…
A: Promoter is a specific sequence of dna, where it's length can vary from organism to organism.…
Q: what is the qualitative anatomical analysis of a squat active
A: A basic human movement that may be seen in almost all facets of life is the squat. In addition, it…
Q: You cannot get a cavity, tetnus, or sinus infection from another person. This means that all of…
A: Tetanus is a disease of nervous system which is caused by a toxin producing bacteria. This disease…
Q: Reproductive isolation leads to induced mutations emergence of separate species immunity to genetic…
A: Answer: The correct answer is option 3)immunity to genetic drift.
Q: Photosynthesis concept map scaffold organelle where Preactions occur is has membranes called genente…
A: Phototrophs utilize the process of photosynthesis to transform light energy into chemical energy,…
Q: 542 lizard PALEOZOIC (a) human backbone hair dog human 251 Millions of years ago hair (b) lizard…
A: A phylogenetic tree is a diagrammatic illustration which tells how species are closely related to…
Q: Why is it important that NEB express I^q cells do not have endonuclease? What could happen if they…
A: A cell is a mass of the cytoplasm that is bound externally by a membrane called as the cell…
Q: dienestrol. Expre a ratio strength.
A:
Q: A) What module can we use to run BLAST over the internet in Biopython: Bio.Blast.NCBIWWW…
A: Biopython is a popular application programming interface (API) containing free tools, and are…
Q: What are the advantages of using genetically encoded calcium markers over other calcium markers?…
A: Ca2+ is a pervasive intracellular messenger that controls various cellular processes in many organ…
Q: Why is it important that NEB express I^q cells do not have proteases? What could happen if they did?
A: NEB express Iq cells are E.coli cells, are chemically competent cells with high efficiency and are…
Q: Determine if prophase of mitosis contains 2 chromatids or only one chromatid.
A: Introduction One cell (the mother) divides into two new cells (the daughters) that are genetically…
Q: -emes that Force static bodies? 7
A: Homeostasis is the tendency to resist change in order to maintain a stable, relatively constant…
Q: The Law of 10 determines all the following characteristics except one. W the Law of 10 NOT…
A: 10 percent law determines all the characteristics except one?
Q: Assume that blood type is inherited as A and B dominant over O, but A and B are codominant over each…
A: Proteins for blood groupings such as A, B are present on the surface of red blood cells.
Q: the function of the cell membrane and pathogenicity of covid.
A: What are the Function of the cell membrane and pathogenicity of SARS-Cov2
Q: Considering the values in the following table, what relationship can be observed between the amount…
A: WATER POTENTIAL - Water potential is the amount of energy needed to move an infinitesimally small…
Q: Drag each of the following events to the location where they occur in a eukaryotic cell Nucleus…
A: Introduction The process through which a gene's information is used to produce either RNA molecules…
Q: How much of a 10 mg/ml DNase stock would you need to add to 4 mL of cells for a final concentration…
A: DNA ( deoxyribonucleic acid ) is a two stranded helical structure that functions as genetic…
Step by step
Solved in 3 steps
- The linear dsDNA genome of λ binds on the LamB receptor of E. Coli and conducts a normal lysogenic cycle. Exposure to stress will cause the excision of λ prophage from the E. Coli genome. The excised λ genome is then replicated, packaged, and released from the cell as mature λ phage particles and ready to infect other bacterial cells. Among λ phage particles,the transducing phage mediates a specific type of recombination. Understand this scenario and answer the following questions. 1. What are the basic requirements for the insertion of λ into the E. Coli genome? 2. What special features are found in the λ insertion site? 3. What type of recombination occurs with λ insertion in the E. Coli genome? 4. How you will differentiate λ transducing phage from normal λ phage? 5. What exclusive mechanism λ phage utilizes for recombination?when various strains of lambda phage are seeded on a lawn of e.coli, they can form clear or turbid plaques. Explain the difference between the two types of plaques. can all bacteriophage form clear and turbid plaques?When various strains of λ phage are seeded on a lawn of E. coli, they can form clear or turbid plaques. (b) For mutant λ phages that can only form clear plaques, give two different types of mutation in the phage that can explain the clear plaque phenotype.
- When bacteriophage P1 causes E. coli to lyse, the resulting materialis called a P1 lysate. What type of genetic material would befound in most of the P1 phages in the lysate? What kind of geneticmaterial is occasionally found within a P1 phage?A bacteriophage λ is found that is able to lysogenize itsE. coli host at 30°C but not at 42°C. What genes may bemutant in this phage?In Hershey-Chase experiment, bacteriophages protein coats were tagged with radioactive isotope S-32. These phages were used to infect E. coli cells and the cells were further centrifuged to form pellets. Why was the radioactivity level of S-32 found greater outside the cells compared to the E. coli cell pellets? Explain briefly. If the experiment is repeated in the same manner but this time the phage protein coats are labelled with isotope X and the phage DNA with isotope Y, which isotope’s radioactivity will be found in greater amounts in the E. coli cell pellets after centrifugation? Explain briefly.
- A microbial geneticist isolates a new mutation in E. coliand wishes to map its chromosomal location. She usesinterrupted-mating experiments with Hfr strains andgeneralized-transduction experiments with phage P1.Explain why each technique, by itself, is insufficient foraccurate mapping.An ade+ arg+ cys+ his+ leu+ pro+ bacterial strain is knownto be lysogenic for a newly discovered phage, but the siteof the prophage is not known. The bacterial map isleucysarghisadeproThe lysogenic strain is used as a source of the phage, andthe phages are added to a bacterial strain of genotypeade- arg- cys- his- leu- pro-. After a short incubation,samples of these bacteria are plated on six differentmedia, with the supplementations indicated in thefollowing table. The table also shows whether colonieswere observed on the various media.PresenceMedium Ade Arg Cys His Leu Pro of colonies1 - + + + + + N2 + - + + + + N3 + + - + + + C4 + + + - + + N5 + + + + - + C6 + + + + + - NNutrient supplementation in medium(In this table, a plus sign indicates the presence of anutrient supplement, a minus sign indicates that asupplement is not present, N indicates no colonies, and Cindicates colonies present.)a. What genetic process is at work here?b. What is the approximate locus of the prophage?The protein of T2 bacteriophage is labeled with 35S and the DNA with 32p. Where would one detect most of the 32p if the T2 bacteriophage were allowed to infect the bacteria? O on the phage coat surrounding the T2 bacteriophage on the membrane of the infected bacteria O inside the T2 bacteriophage capsid O inside the infected bacteria O The 32P would be equally distributed within the T2 bacteriophage and infected bacteria
- Describe the process of replication of a Lytic phage and a Lysogenic phage. In your answer you must include the different steps of the replication process as well as appropriate terms used to name these steps of the process. Compare and contrast both methods of replication and indicate the relevance of lysogenic cycle of phage replication to bacterial antibiotic resistance.One of the reasons why phage therapy has not been applied widely is that bacteria can become resistant to bacteriophages as well, through mutations in genes encoding for specific proteins. What would be a protein in the bacterial cell that, if mutated, would make that cell resistant to phage infection?What would happen to the ability of bacteriophage λ tolyse a host cell if it acquired a mutation in the OR bindingsite for the Cro protein? Why?