TOPIC: TEENAGE PREGANANCY Home Visit Plan Background/Rationale: Goal: DATE AND TIME SPECIFIC OBJECTIVES ACTIVITIES METHODS/STRATEGY/MATERIALS EVALUATION (SEPT 26-29) TO BE USED DAY 1-3
Q: What assessments do you need to make? What do you think the problem is? (Is it a real or is it a…
A: The two hormones which are involved in the lactation are prolactin and oxytocin. Prolactin which is…
Q: The nurse performing a postpartum assessment on a cllent, and notes the presence of clots in the…
A: The nursing assessment is the initial step in the nursing process. It helps in gathering information…
Q: Formulate a Discharge Plan on a 3- year-old male child diagnosed with Diabetes Mellitus Type 1. his…
A: Type 1 diabetes is a medical condition in which the cells in the pancreas that produce insulin or…
Q: NURSING CARE PLAN (please take note that the mother is postpartum already) Cues Nursing Diagnosis…
A: Note : As per our company policy we won't provide reference. Nursing care plan contains the…
Q: Case Scenario As the nurse working on a postpartum unit, you are caring for Mark and Mara, who have…
A: There are many hormonal changes occurring during and after pregnancy. The changes in hormonal…
Q: a Discharge Plan for a 3-year-old male child newly diagnosed with Diabetes Mellitus Type 1. Use the…
A: Type 1 diabetes is a disease which affects the child's body in making or producing the insulin and…
Q: ovide details on Intrauterine device for contraception including components, indications for use,…
A: We know The intrauterine device (IUD) is a T-shaped device inserted into the uterus for birth…
Q: DONT ANSWER THE SAME ANSWER ANYMORE. PLEASE INCLUDE REFERENCES I NEED IT. please make a…
A: As per the Maslow’s Hierarchy of Needs there are 5 levels to prioritize patient care, which is from…
Q: celcius
A: 1. The patient has got Lactation Mastitis , this is an inflammation of breast tissue with…
Q: the GTPAL system, how would the nurse document the client’s obstetric history? Question 24 options:…
A: Asking inquiries about a patient's current and past pregnancies is part of an obstetric history.…
Q: 1. Read and Analyze the Pregnancy Case Scenario 2. Develop a basic nursing care management for a…
A: A 35- year old woman gravida 1 and para 0 that means she is elderly primigravida. She is suffering…
Q: perinatal assessment of a pregnant woman -lmp, aog, edc geriatric assessment
A: Perinatal period and perinatal assessment Perinatal period encompasses the time frame from one year…
Q: describe the importance of three specific resources the RN needs to care for the patient.
A: The increased level of glucose during gestational period due to lack of insulin hormone will leads…
Q: Please give me a possible nursing diagnosis of the following? 1. Small for gestational age 2.…
A: Small for gestational age- baby who is smaller than the usual amount for the number of weeks of…
Q: What will be the more specific actions of the nurse for this
A: Family health nursing is the process of achievement of optimum health by the family with mediation…
Q: Nurse Zasha is monitoring Mrs. Zexy Lucero, G1P0, who is at 6 cm cervical dilatation. 80% effaced,…
A: Labor: Regular uterine contractions with gradual cervical dilatation and effacement are considered…
Q: Case Scenario 5: Postpartum mother A: Aling Mila gave birth at home thru the help of a Hilot…
A: Postpartum care: It requires standard patient care and several interventions Nurse takes up the…
Q: An 18-year-old woman presents for care because a condom broke during sexual intercourse. Coitus…
A: Condoms are contraceptive measures that are used to prevent the transfer of sexually transmitted…
Q: TOPIC: TEENAGE PREGANANCY Home Visit Plan Background/Rationale: Goal: DATE AND TIME SPECIFIC…
A: Home visit is one of the most important parts of health services in the community as most of the…
Q: The client visited La Loma Health Center to consider the use of contraceptives. To expedite a…
A: Contraceptive is also known as birth control used for preventing pregnancy. It prevent the sperm…
Q: You will continue to fill up the table using the same case scenario given in lesson 4. This time you…
A: Labor is an excruciating process of giving birth to a new life. It is during this process that…
Q: Make a learning objective for this topic: topic: Basics of teenage pregnancy (Definition, Causes,…
A: Learning objectives: 1. After 2 minutes of discussion, the client will be able to define teenage…
Q: What initial nursing interventions can you provide to the client? Briefly , provide the rationale.…
A: After the postpartum, the fundus in the uterus becomes less firm and muscles lack frequency of…
Q: . Which of the following is most important when caring for high risk postpartum patients? A.…
A: Question no. 2 is related to maternity nursing Solution given below Question no. 3 to 5 repost…
Q: The nurse should include which of the following statements when providing education to the parents…
A: Nurses must properly explain medical treatments to patients and acquire consent when needed. The…
Q: Identify the nursing responsibilities/interventions to a woman in labor, from the time of admission…
A: Nursing care for pregnant women at the time of labor is highly challenging as nurse practitioners…
Q: LIST 10 QUESTIONS REGARDING (COPING-STRESS TOLERANCE - GORDONS IN NURSING) THAT RELATES TO MATERNAL…
A: Marjorie Gordon is a professor and nursing theorist who proposed the nursing assessment theory…
Q: CASE NUMBER 2 Nursing Care of the Child with Physical or Developmental Challenge Client profile:…
A: The physical challenge is the inability of the person to move freely as the primary sense is…
Q: Ideal weight of a child (Table 12.1) is 4.2 kg at 1 month, 5.6 kg at 3 months, 7.7 kg at 6 months,…
A: Introduction:- Child is having weight of 18.1kg and is 5years old. Morphine solution is available…
Q: need the ICD-10-CM codes and ICD-10-PCS codes for : The pstient had an elective abortion performed…
A: A TERM OF ELECTIVE ABORTION A WOMEN CHOOSE (ELECTIVE) TERMINATION OF PREGANACY BEFORE 20 WEEK OF…
Q: SITUATION: Bella Bernardo 24 year old gravida 4 para 2 visits the prenatal clinic for her check-up.…
A: Bella bernardo is 24 years old female. She is gravida 4 and para 2 . Her LMP is 21 August 2020.
Q: SITUATION: Bella Bernardo 24 year old gravida 4 para 2 visits the prenatal clinic for her check-up.…
A: Bella bernardo is 24 years female. She is gravida 4 and para 2 . Visiting the prenatal clinic. Her…
Q: The nurse is evaluating the client who delivered vaginally 2 hours ago and is experiencing…
A: Postpartum pain or afterpains It is spasmodic infrequent colicky pain present in the lower abdomen…
Q: Bella Bernardo 24 year old gravida 4 para 2 visits the prenatal clinic for her check-up. Her last…
A: Gestation age -- It is the measurement of the duration of pregnancy from the last menstruation…
Q: The nurse practitioner is performing a short assessment ofa newborn who is displaying signs of…
A: Assessment is the collection of essential data to help the nurses to gain knowledge on the…
Q: 1. What ideas might Roberta suggest to help James overcome his distaste for hospital deliveries? Can…
A: Note: We are authorized to answer one question at a time since you have not mentioned which question…
Q: Client Situation Two You are caring for a client in active labor. The client and her partner have…
A: Ethics are the branch of the philosophy. It's defines the individual and social morality.
Q: A group of student-nurses are about to conduct a community diagnosis. Which of the following…
A: DEFINITION Community diagnosis is the identification and quantification of health problems in…
Q: 1. What is the Ballard scoring system? 2. Describe the physical characteristics of a preterm infant.…
A: Note: According to the guidelines, only one question is to be answered. Please ask other questions…
Q: Make a learning objective for this topic: topic: Basics of teenage pregnancy Learning objective…
A: Pregnancy should be handled with the utmost care by the mother and special focussed care should be…
Q: It has been 1 week since Mrs. Cruz gave birth to a 7-pound, 8-ounce daughter. She has elected to use…
A: The time period following child birth is a very crucial one. It is know as postpartum period. During…
Q: by se would be most benefic Answers A-D A Perhaps you could benefit from counseling since your…
A: Ans. Parents and child interaction or relationship plays an important role in child's…
Q: A client attending the prenatal clinic for the first time tells the nurse that her last menstrual…
A: One of the first symptoms of pregnancy is a missed menstrual cycle. LMP date or the last menstrual…
Q: Lily accompanied by her husband come for her 6-week postpartal check-up. Lily, who has just become…
A: Note: Hi. Since you have asked many questions. The first question will be answered and if you want…
DO NOT CANCEL, I WILL UPVOTE PLEASE
Formulate a HOME VISIT PLAN about teenage pregnancy. (health teaching)
important notes:
- specific time and date should have specific objectives.
- pls base on the chart below
Step by step
Solved in 2 steps
- testnavclient.psonsvc.net/#/question/3c84727c-923f-43e6-b886-7a4df16a5c34/87dc7a9e-4def-4dd2-8ad8-724b9a914198 Review - A Bookmark tete, edilmar AKE S2 Bio Unit 5B Common Unit Assessment / 1 of 9 II Pau Use the picture to answer the following question. Plant Grasshopper Frog Snake Eagle Suppose 10,000 units of energy are available at the level of the plants. How many energy units would be passed from the frog to the snake? O A. 100 units O B. 1,000 units O C. 10 units D. 10,000 units Sign outReporting Category 4: Biological System and Processes Fill in the function and major organs of each system, as well as how they interact with other systems. Use the Functions Word Bank provided at the end of table to help complete the table. Interaction(s)- Working with Other Systems System Function(s) Diagram Digestive List the • 1. With circulatory: major organs: 2. With muscular: 3. With nervous: Circulatory List the major organs: 1. With respiratory: 2. With digestive: 3. With immune: 4. With nervous: 5. With endocrine: Nervous List the major organs: 1. With muscular: 2. With endocrine:CS_Chapter 34.docx nd.orbundsis.com/einstein-freshair/Videos/D671260A4C0A005E4832B3E307A98B64/CS_Chapter_3- (6) The Reason Why... om: Onlin... + Beyond The Lights... Isaiah Blames Zora... Watch Mar ase Study, Chapter 34,Nursing Assessment 1. Mr. Simms has been admitted to your unit complaining of chest pain. You introduce yourself to Mr. Sims and begin the nursing assessment. How will you explain the significance of the nursing assessment to Mr. Simms? (Learning Objectives 1, 2) 2. The following information is data collected from Mr. Simms. Label each piece of data collected with an (s) for subjective data or an (o) for objective data. Mr. Simms is a 65-year-old male presenting with "crushing chest pain radiating down the left arm to the fourth and fifth fingers." Temperature 99.0°F Pulse80 Respirations 16 Blood pressure 190/98 Oxygen saturation 96% 3. List three ways you will collect data from Mr. Simms. Complaints of nausea and dyspnea. Skin moist and pale. Oriented to person, place,…
- 8:41 X Case Study 4 - Reproductive.docx : Case Study 4 - Reproductive Disorders Instructions: All questions apply to this case study. Your responses should be brief and to the point. Cite reference page(s) from Timby, Rosdahl, Drug Guide and ATI books. When asked to provide several answers, they should be listed in order of priority or significance. Do not assume information that is not provided. L. A. is a sexually active 15-year-old who lives in a suburban neighborhood with her parents and two younger sisters. She does not confide in her parents about her activities, but rather discusses them with her two best friends in high school, who also are sexually active. Last week a guest speaker at school discussed the topic of sexually transmitted diseases (STDs) which L. A. thought quite a bit about since the discussion. She has an appointment tomorrow for her annual gynecologic examination. In the privacy of the examination room, L. A. tells the nurse about her sexual activity and…BIO 168 Case Studies Unit 5 gs Review View O Tell me 斗 AaBbCcD AaBbCcDdE AaBb AaBbCcDdEe AaBbCcDdEe A v H v No Spacing Normal Heading 1 Heading 2 Title Styles Pane Case Study #7 Ayoung woman was playing in a rugby game when she was knocked down. She was momentarily stunned, "saw stars," and had blurred vision for approximately 30 seconds. After resting for several minutes no symptoms remained except a lingering headache. 1. What may the lingering headache indicate? 2. After a few weeks the rugby player lost her sense of smell. Reexamination showed a fractured ethmoid bone. Why could this fracture cause the loss of her sense of smell? 3. Will it return? Why or why not?thl?deploymentld=5686091822001160682 CENGAGE MINDTAP 4 MindTap Assignment: Chapter 1 - Test Yourself Assignment: 1.4 MindTap Assignment: Chapter 1 - Test Yourself Questions fr3am08h_ch01.07m 2. 3. 4. Managed care: a. is not relevant in today's electronic medical office 5. O b. does not require any preauthorization for tests or surgeries 6. Oc. impacts the way medical assistants perform their jobs by adding additional paperwork 7. O d. is a thing of the past 8. O e. is not relevant in today's health care system 9. 10. 11. 12. 13. 14. 15. 16. 17. O- Icon Key 18. 19 fr3am08h_ch01.07m search
- Test on the Prac X Apps Bb About this Modi x Question Completion Status: Secure https://blackboard.le.ac.uk/webapps/assessment/take/launch.jsp?course_assessment_id=_39582_1&course_id=_41417_1&content_id GIv Bag, Medical Dr... JD Fila Disruptor II R... 3. Edexcel Revisio... P Edexce Unavailable in you... www.20m 2.50M d. 0.208M e. 2.50MM QUESTION 8 Bb Reassessments X QUESTION 9 Palmar Oceanfron... Amazing Opportu... You need to make 500mL of a stock solution of sodium chloride at a final concentration of 250mM. How many grams of sodium chloride needs to be weighed out? The molecular mass of sodium chloride is 58.5. (Give you answer to 3sf) esc A 2.0kb bacterial plasmid 'BS1030' is digested with the restriction endonuclease Sau3A, the plasmid map is depicted in the diagram below and the Sau3A (S) restriction sites are indicated. S0.00/2.00 Bb About this Modi X Bb Practical report X indicates plasmid 'BS1030' fully digested with Sau3A? The DNA marker used is the 50 bp ladder, which…* My Home Content Take Test: Unit 1 Exam - BIOS x Q chapter 24 Flashcards | Quizle x O New Survey - UIC Healthchec X A uic.blackboard.com/webapps/assessment/take/take.jsp?course_assessment_id=_395458_1&course_id=_200855_1&content_id=_9051211_1&question_num_3.x=0... Apps Яндекс.Переводчи.. O Part-Time Lecturers. A Google Maps تمارين صعبة ولكنها ا. . . ي الشيخ عبد الباسط ع. .. رجيم كامل يحق ق التنح.. الزنجبيل وال ليمون أهم. . . E Reading list Remaining Time: 5 minutes, 42 seconds. * Question Completion Status: 12 Kauai Picture-winged Drosophila Oldest island Oahu Maui complex 40 - Youngest island 26 Hawaii © 2001 Sinauer Associates, Inc. Examine the figure above. Arrows represent times that an ancestral species of Drosophila moved from one island to another and underwent a speciation event. This movement promotes what kind of speciation? O Morphological speciation O Allopatric speciation O Ecological speciation O Sympatric speciation P Type here to search 5:13 PM 73°F O G 1x ENG 74…pter 25- Google Docs New Tab tro/Case%20Study Trauma%28revised%29.pdf?time=1636054242025 1 / 1 100% + Case Study - Trauma You and your partner have been dispatched to a report of a motorcycle crash on a curvy back road. Fellow riders at the scene reported the patient was travelling too fast to negotiate a sharp curve and was thrown over a guardrail into a tree. They carried the patient up an approximate 4-foot embankment to the road. Upon your arrival, you find a male patient you estimate to be between 20-25 years of age, being cared for by a police officer who has opened the airway using an NPA and is administering oxygen via an NRB. The officer reports the patient has been unconscious since she got to the scene. Looking down the embankment, you see the patient's helmet and note it has sustained significant damage. As you approach the patient, you observe the patient has gross angulation involving his left lower leg and deformity to his right humerus. 1. In addition to scene safety,…
- II Log In x b My Que X d.cuny.edu/webapps/assessment/take/take.jsp?course_assessment_id%3 2077934_ 1&course_id%3 2021853 18content id 62810464 18 Remaining Time: 1 hour, 31 minutes, 54 seconds. * Question Completion Status: Moving to the next question prevents changes to this answer. Question 2 AAGTCAAGAAGAAGAAGAAGCC A. The nucleotide sequence above is a STR of how many repeats? B. What sequence is being repeated? For the toolbar, press ALT+F10 (PC) or ALT+FN+F10 (Mac), TTTArial 3 (12pt) E: - L ^ The nucleotide sequence5 above is 5 The sequence being repeated is AAG I 41°F e here to searchom utn TestNav tnavclient.psonsvc.net//question/e6df53e9-2e7e-41f0-a022-a36fb463c957/c2363c6e-c38d-4d11-bfc9-ff25ea8b8c0c tete, edilma Review - Bookmark E S2 Bio Unit 4A Common Unit Assessment/3 of 10 Use the image to answer the following question. The image shows a model of a reproductive strategy of an organism. What type of reproductive strategy is shown in the model and what is an evolutionary disadvantage of it? O A. Asexual reproduction; organisms that utilize this strategy lack gengtic diversity which limits their ability to adapt to frequent changes. Sign E T. U D F G H J KL CV BN M COCW7 Due 3/1 X C Chapter 5: In x M Inbox (3,574) X M Inbox (244) M Midterm ma X b Search result x G how to scree + https://peralta.instructure.com/courses/39459/quizzes/131066 B MERRITT |COLLEGE Account Dashboard Courses Skin Drawing 1 Calendar Using Skin Drawing 1, match the tissue types on the right column to the lettered regions in the left column: Inbox A keratinized stra History В dense irregular Studio C areolar connect Starfish D Help reticular conne 3:58 PM O Type here to search ENG 3/22/2021