Transcribe and Translate the DNA strand: ORIGINAL DNA TAC/ACC/TTG/GCG/ACG/ Strand: RNA strand: Amino Acid sequence: All the DNA strands below are mutated from this Original strand. Please transcribe and translate the DNA strands below and then compare the mutated strands to the ORIGINAL above. Highlight the changes. Tell me what type of mutation has occurred. Mutated DNA Strand #1 Mutated DNA strand #1: TAC/ATC/TTG/GCG/ACG/A RNA strand: Amino Acid sequence: What type of mutation is this? Will there likely be effects? Mutated DNA Strand #2 Mutated DNA strand #2: TAC/GAC/CTT/GGC/GAC/G. RNA strand: Amino Acid sequence:

Transcribe and Translate the DNA strand: ORIGINAL DNA TAC/ACC/TTG/GCG/ACG/ Strand: RNA strand: Amino Acid sequence: All the DNA strands below are mutated from this Original strand. Please transcribe and translate the DNA strands below and then compare the mutated strands to the ORIGINAL above. Highlight the changes. Tell me what type of mutation has occurred. Mutated DNA Strand #1 Mutated DNA strand #1: TAC/ATC/TTG/GCG/ACG/A RNA strand: Amino Acid sequence: What type of mutation is this? Will there likely be effects? Mutated DNA Strand #2 Mutated DNA strand #2: TAC/GAC/CTT/GGC/GAC/G. RNA strand: Amino Acid sequence:

Name: 11:49 1Transcribe and Translate the DNA strand:ORIGINAL DNATAC/ACC/TT
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 11:49 1Transcribe and Translate the DNA strand:ORIGINAL DNATAC/ACC/TTG/GCG/ACG/ACStrand:RNA strand:Amino Acidsequence:All the DNA strands below are mutated fromthis Original strand. Please transcribe andtranslate the DNA strands below and thencompar

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter14: Dna Structure And Function

Section: Chapter Questions

Problem 37CTQ: An adult with a history of tanning has his genome sequenced. The beginning of a protein-coding...

See similar textbooks

Similar questions

12:49 0 14. You want to amplify the DNA between two stretches of sequence shown in the figure below. Explain which one of the following primer pairs would allow you to amplify the DNA by PCR. DNA to be amplified 5'-GACCTGTGGAAGC -CATACGGGATTGA-3" 3'-CTGGACACCTTCG GTATGCCCTAACT-5" primers (1) 5'-GACCTGTCCAAGC-3 (2) 5-CTGGACACCTTCG-3 (5) 5-CATACGGGATTGA-3" (6) 5°-GTATGСССТААСТ-3° (3) 5'-CGAAGGTGTCCAG-3' (7) 5'-TGTTAGGGCATAC-3" (4) 5'-GCTTССАСАGGTC-3° (8) 5'-TCAATCCCGTATG-3' END 5 THE END
7:07 1 How Mutations Occur (Developing) Question O Practice It! /// A Select the statement(s) that accurately describe the function of DNA polymerase and the types of mutations that may occur. O Point mutations occur when a single nitrogenous base is substituted. Frameshift mutations occur when a nitrogenous base is inserted or deleted. start d le O Point mutations are less serious than frameshift mutations, as only a single base pair is affected. DNA has rare mutations during replication because DNA polymerase functions to build and repair errors in nitrogen base pairings of A-G and T-C. 3 Pro O DNA has rare mutations during replication because DNA polymerase functions to build and repair errors in nitrogen base pairings of A-T and G-C. O Point mutations occur when a nitrogenous base is inserted or deleted. Frameshift mutations occur when a single nitrogenous based is substituted. B.McKenzie - Uncontrolled Cell Growth B.McKenzie - Uncontrolled Cell Growth B.McKenzie - Uncontrolled…
7:25 7 copiea imto a new molecule of RNA. What happens during the TERMINATION step of transcription? A. base pairs are added to the mRNA transcript B. RNA polymerase starts creating the mRNA transcript C. RNA polymerase stops adding bases to the mRNA transcript, causing the mRNA to separate from the DNA Copyright © 2003 - 2022 International Academy of Science. All Rights Reserved. 7
Stiller Paragraf how/or which the DNA repair mechanism fixes each mutation? (Ctri)
DNA GAAGGGACAATACTTTCTTAACACTTG MRNA Amino Acid Sequence 1. Which kind of protein molecule did this gene make? 2. How does this protein help the body maintain homeostasis? Conclusion Questions: 1. Examine the protein you created. If the DNA strand that you started with had a change in it (A changed to G), what would happen to the protein made?
11:29 Protein 6-10092015113530.pdf https:api.schoology.comv1attachment169963838... Name Class Date 2. How are enzymes involved in this process? 3. hаppens anzips"? 4. Why is it important that exact copies of DNA be made? 5. Suppose that a sequence of one DNA strand is T-A-C-A-A-C-G-T-G. What is the corresponding sequence on the other strand? E Concept Mapping The construction of and theory behind concept mapping are discussed on pages vil-ix in the front of this Study Guide. Read those pages carefully. Then consider the concepts presented in Section 7-1 and how you would organize them into a concept i page 74. Notice that the concept map has been started for you. Add the key Now look at the concept map for Chapter 7 on concepts you are important Secti When you have finished the chapter, you will have a completed concept map. 69 1 of 1
wol for Frayon Elolog - Meet - cha-gX-m sc Jupiter Ed G Which orgerell= A sample of DNA is collected from an organism. It is analyzed and determined that 20% of the DNA is made up of the base adenine. Based on this information, which of the following correctly lists the amounts of the three. remaining bases for this sample? 10% cytosine, 30% thymine, 40% guanine O 20% cytosine, 20% thymine, 20% guanine 30% cytosine, 30% thymine, 20% guanine 30% cytosine, 20% thymine, 30% guanine p. 5 of 31
-66 The following sequence of the DNA template strand contains: 5'AGGCTCCAGG 3' out of Which complementary RNA strand can be made from this sequence? uestion Select one: O a. 5' UCACAGGUCU 3" O b. 5' UCCGAGGUCU 3" O c.5' CCUGGAGCCU 3' O d. 5' UGGCTCCUGC 3' e. 5' GACCTCGGAA 3"
Give the complimentary DNA strand for the following:ACG TAG CTA GTC AGT CGT AGC Give the RNA strand for the following:ACG TAG CTA GTC AGT CGT AGC Using the provided amino acid table and the RNA strand you created in #2, create the amino acid sequence: Name and explain two different ways in which DNA can be damaged. Once DNA is damaged, can we repair it? If not, what are some possible outcomes from the damaged DNA?
Transposons are useful as mutagens because they act asmolecular tags for genomic DNA sequences that can beidentified rapidly by inverse _______
Where is the substitution indicated on the original DNA strand? May you please Write it out and bold the nucleotide.
7:12 You have completed an in vitro mutagenesis experiment to create an G to T mutation in the coding sequence of the heat shock protein gene. This gene is cloned in a plasmid and you want to confirm that the mutation was correctly introduced. Which sequencing technology be most appropriate to use practically and economically: O Microarray O Sanger sequencing O RNA sequencing O Exon sequencing