Using the codon charts in your text (section 6.1), fill in the chart below. [ /8] Original DNA sequence TAC GGA CAC GTT CGC AAC mRNA sequence tRNA anticodons Amino acid sequence Mutated DNA sequence TAC GGA CAC ATT CGC AAC mRNA sequence tRNA anticodons Amino acid sequence Type of mutation (highlight all that apply) Frameshift Nonsense Missense Silent Insertion Deletion Substitution

Using the codon charts in your text (section 6.1), fill in the chart below. [ /8] Original DNA sequence TAC GGA CAC GTT CGC AAC mRNA sequence tRNA anticodons Amino acid sequence Mutated DNA sequence TAC GGA CAC ATT CGC AAC mRNA sequence tRNA anticodons Amino acid sequence Type of mutation (highlight all that apply) Frameshift Nonsense Missense Silent Insertion Deletion Substitution

Name: Using the codon charts in your text (section 6.1), fill in the chart b
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: Using the codon charts in your text (section 6.1), fill in the chart below. [ /8] Original DNA sequenceTAC GGA CAC GTT CGC AACmRNA sequence tRNA anticodons Amino acid sequence Mutated DNA sequenceTAC GGA CAC ATT CGC AACmRNA sequence tRNA

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 13QP: A frameshift mutation is caused by a: a. nucleotide substitution b. three-base insertion c....

See similar textbooks

Similar questions

mRNA Codon Chart: Second letter с บบบ UCU UAU Phe UUC UCC U Ser UAC Tyr UGU UGC Cys UUA UCA Leu UAA Stop UGA Stop A UUG UCG UAG Stop UGG Trp CUU CCU CAU CGU CUC CCC His CAC Leu Pro CUA CCA CAA CGA Arg Gin CUG CCG CAG CGG AUU ACU AAU AUC lle ACC AAC AGU ]Asn Ser AGC A Thr AUA ACA AAA Lys AGA Arg AUG Met ACG AGG GUU GCU GAU GUC GCC Val GAC Asp GGU GGC Ala GUA GCA GUG GCG GAG GGG GAA Glu GGA Gly Amino Acid 3-Letter Codes Name of Amino Name of Amino 3-Letter Code 3-Letter Code Acid Acid Alanine Ala Leucine Leu Arginine Arg Lysine Lys Asparagine sex Methionine Met (start) Aspartic Acid Asp Phenylalanine ebe Cysteine Cve Proline Pro Glutamic Acid Glu Serine Ser Glutamine Gln Threonine Glycine GLK Tryptophan JAR Histidine His Tyrosine Tyr Isoleucine lle Valine Val Exercise: Transcription & Translation 1. Choose 3 DNA Templates. 2. Write the mRNA sequence divided into 3 letter codons. 3. Write the sequence of amino acids. 4. Find the corresponding amino acid sequence and include the letter of…
The codon chart below shows that adenine-uracil-guanine (AUG) codes for the amino acid methionine, and cytosine- adenine-guanine (CAG) codes for glutamine in humans. RNA Codon Chart UCAGUGA Alanine Tyrosine Stop Cystoine Stop Valine G U A GTryptophan Arginine A Leucine Serine Lysine Proline Asparagine ACU lGACU Select the two amino acids that those two codons code for in carrots. O glutamine O isoleucine methionine serine O valine oupne Glycine Phenyl- acid Asparti oartic acid Histidine Glutamine Arginine uauonejos Methionine Threonine
If DNA segments changes from GCATAG to GCATA, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base U A G 0001 Phenylalanine UCU UAU1 Tyrosine (Tyr) UAC UGUT FCcysteine (Cys) UGCJ U UUCJ (Phe) UCC Serine (Ser) UCA U UUA1 UAAT UGA - Stop A FLeucine (Leu) UUG- FStop UAG- UCG- UGG - Tryptophan (Trp) G CU- CCU CGUT CAU1 Histidine (His) CAC U CUC FLeucine (Leu) CUA CC Proline (Pro) CCA CGC FArginine (Arg) CGA CAA1 Glutamine A CAGI (Glu) CGG- CUG- CCG- G AUU AAU1 Asparagine ACU1 AGUT FSerine (Ser) AGC- AUC FIsoleucine (le) ACC Threonir AACJ (Asn) A AUA- ACA (Thr) AAA1 FLysine (Lys) AAG- AGA, FArginine (Arg) AGG- A Start Methionine (Met) ACG- AUG - GUU- GCU GAU- GGU | Aspartic Acid GAÇJ(Asp) U GỤC Valine (Val) GUA GCC FAlanine (Ala) GGC Glycine (Gly) GGA G GAA1 Glutamic Acid A GCA GCG- GAGJ (Glu) GGG- GUG- G
If the sequence of amino acids encoded by a strand of DNA is serine-alanine-lysine-leucine, what is the order of bases in the sense strand of DNA? Use the codon chart below to help you: second letter A G UAU Tyr UGU UUU UCU Phe Сys UUC UCC UAC UGC Ser UAA stop |UGA stop | A UAG stop UGG Trp UUA UCA UUG Leu G UCG CUU CCU CAU CGU His CUC ССС САС CGC Leu Pro Arg CUA ССА САА CGA Gln CUG CCG CAG CGG AUU ACU AAU AGU Asn Ser AUC le A AUA AAC AAA AGC AGA Arg АСС Thr ACA AUG Met | ACG AAG Lys AGG GUU GCU GAU GGU Asp GUC Val GUA GAC S GAA Glu GCC GGC Gly GGA Ala GCA GUG J GCG GAG GGG) O 3' AGACGTTTCAAT 5' O 3' UGUGCAAAGUUA 5' О 5 TGTGCTTТCТТА 3' first letter UCAG UCAG PCAG third letter
Using a codon table, complete the DNA triplets, mRNA codons, tRNA anticodons, and amino acids in the table below. DNA triplet mRNA codon tRNA anticodon Amino Acid AAG GGC CAG UUA AAA GTA CUC ACA TAT AGC AUU CCA GGC
The sequence below is a template strand sequence for a gene (a very short one!). Identify the start codon and the amino acid sequence of this gene. Write your answer in 3 letter amino acid code. Put a hyphen between each amino acid. You should also include a description of any working or steps you have taken to determine your answer. 5' AGTCAGCAAGAAGACATCAGTGTTCCCATCTGT 3' Paragraph V B I U A = 8⁰ + v 11.
The following questions refer to this table of codons. Second Base U A G UUU UCU UAU UGU ] Cys Phe Tyr UUC UCC UAC UGC Ser UUA UCA UAA Stop UGA Stop Leu UUG UCG UAG Stop UGG Trp CUU CCU CAU CGU His CUC CCC CAC CGC Leu Pro Arg CUA CCA СА CGA Gin CUG CG CAG CGG AUU ACU AAU AGU Asn Ser AUC Ile ACC AAC AGC Thr AUA ACA AAA AGA Met or Start ] Lys Arg AGG AUG ACG AAG G GUU GCU GAU GGU Asp GAC GUC GCC GGC G Val Ala Gly GUA GCA GAA GGA Glu GUG GCG GAG GGG What amino acid sequence will be generated, based on the following mRNA codon sequence? 5' AUG- UCU- UCG- UUA- UCC- UUG 3' met-arg-glu-arg-glu-arg met-ser-ser-leu-ser-leu met-glu-arg-arg-glu-leu met-ser-leu-ser-leu-ser First Base Third Base
Second letter C A UUU Phenyl- UUC alanine UCU UCC UAU UAC UGU UGC Tyrosine Cysteine Serine UCA UCG UAA Stop codon UAG Stop codon UGA Stop codon UGG Tryptophan UUA A Leucine UUG CCU ССС CAU CAC CUU CGU CGC Histidine C CUC C CUA Leucine Proline Arginine CCA СCG CGA CGG A CAA CAG CUG Glutamine AGU AGC AUU AAU ААС ACU Asparagine Serine AUC Isoleucine A AUA ACC АСА Threonine AAA AGA Methionine; start codon ACG Lysine Arginine AUG AAG AGG U GUU GUC GUA GCU GCC GCA GAU Aspartic GAC acid GGU GGC GGA GGG Valine Alanine Glycine GAA Glutamic GAG acid GUG GCG G Given the codon UCA in the first exon of a gene, which change is most likely to result in a nonsense mutation? A transversion of A to U Change of nucleotide in the third position Change of nucleotide in the first position A transition of A to G Change of nucleotide in the second position First letter Third letter
READ INSTRUCTIONS WND COMPLETE MRNA CODON COLUMN
For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG G
Frameshift mutation _____________________ Select one: can result in a completely new codon sequence that results in the production of non-functional proteins. applies to the reading frame (sequence of codons) being changed. All of the choices are correct. most of the happen when one or more nucleotides are inserted or deleted from the DNA.
First letter U UUU Phenyl- UUC alanine Leucine UUA UUG CUU CUC CUA CUG AUU AUC Isoleucine AUA AUG GUU GUC Leucine GUA GUG Methionine; start codon Valine Normal, wild-type sequence A. mutation I mutation A UCU UCC mutation C UCA UCG mutation B CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC B. mutation II C. mutation III Point mutations are underlined. GCA GCG Second letter Serine Proline Threonine Alanine UAU UAC Tyrosine UAA Stop codon UAG Stop codon CAU CAC CAA CAG AAU AAC Histidine Glutamine Asparagine AAA AAG Lysine GAU Aspartic GAC acid GAA Glutamic GAG acid G UGU UGC Cysteine UGA Stop codon A UGG Tryptophan G CGU CGC CGA CGG AGU AGC AUG UCU CGG GCU UAC AUA UCU CGG GCU UAC AUG UUU CGG GCU UAC AUG UCU AGG GCU UAC GGU GGC AGA AGG Arginine GGA GGG Arginine Serine UOAGUO AGUOAGUCAG Glycine Which mutation would result in a conservative substitution with potentially serious consequences to the translation of the mRNA and synthesis of the protein? Third letter

SEE MORE QUESTIONS

Recommended textbooks for you

Human Heredity: Principles and Issues (MindTap Co…

Biology

ISBN:

9781305251052

Author:

Michael Cummings

Publisher:

Cengage Learning

Human Heredity: Principles and Issues (MindTap Co…

Biology

ISBN:

9781305251052

Author:

Michael Cummings

Publisher:

Cengage Learning

SEE MORE TEXTBOOKS

GET THE APP

About FAQ Academic Integrity Sitemap Document Sitemap

Contact Bartleby Contact Research (Essays)High School Textbooks Literature Guides Concept Explainers by Subject Essay Help Mobile App

GET THE APP

Privacy

Your CA Privacy Rights

Your NV Privacy Rights

About Ads

Manage My Data

bartleby, a Learneo, Inc. business

Original DNA sequence	TAC GGA CAC GTT CGC AAC
mRNA sequence
tRNA anticodons
Amino acid sequence

Mutated DNA sequence	TAC GGA CAC ATT CGC AAC
mRNA sequence
tRNA anticodons
Amino acid sequence
Type of mutation (highlight all that apply)	Frameshift Nonsense Missense Silent Insertion Deletion Substitution