Q: • Choose 1 Infectious Disease and apply the chain of infection cycle. • Alongside each chain,…
A: Below using an infographic, a chain of infection cycle of malaria is explained. Also, how to control…
Q: Use the genetic code table. Which amino acid is coded for by only one codon sequence? Second…
A: Ans is.. methionine
Q: Why is Endo Agar is recommended for membrane filtration experiment and not TSA plate?
A: Membrane filtration is a water sample testing technique. Water is drawn through a specific porous…
Q: at is trinocular microscope
A: A magnifier could be a device that magnifies a picture of a little object, revealing details that…
Q: what is the basic distinction between the sacred and the profane that underlines all religious…
A: Sacred beliefs are those that have values motivation in the society. These are special and have high…
Q: FREE RESIDUAL CHLORINE IS 1. Chloramide compounds 2. hypochlorous or chloric acid 3. haloform…
A: Introduction :- The quantity of chlorine that remains in the water after a given period or contact…
Q: Cellular slime molds (a) include Physarum and Phytophthora (b) are more closely related to bacteria…
A: Protists are the unicellular eukaryotes that vary in size and mode of nutrition.
Q: Discuss the following statement: “primase is a sloppy enzyme that makes many mistakes. eventually,…
A: Enzymes are biocatalysts that aid in the speeding up of reactions. They are proteins that help to…
Q: Imagine a scenario of two hypothetical biomes (biome X and Y) that have identical gamma diversity,…
A: Please follow step 2 for detailed explanation.
Q: The following strand is a template strand: 3'-АТСТАСССТТCGACTAGAАСААСТ-5' The non-template strand is…
A: DNA ( Deoxyribonucleic acid) is ladder like helical structure which act as genetic material in most…
Q: We run the HinDIII-digest of lambda-DNA as the standard ladder on the gel. Number the largest…
A: Lambda-DNA The lambda DNA is approximately 48502 base pairs in length. It can be cleaved by 12…
Q: Definition of term renewable resources, nonrenewable resources, sustainable use, endemic,…
A: Q. Definition of term renewable resources, nonrenewable resources, sustainable use, endemic,…
Q: Which of the following is an explanation for independent assortment of alleles on different…
A: ANSWER;- B) In metaphase I, the alignment of 1 pair of replicated chromosomes does not affect the…
Q: Two linked biallelic loci (c = 0.1) have allele frequencies pA = 0.7 and pB = 0.4. If these two…
A: The degree to which alleles at two loci are associated is measured by linkage disequilibrium (LD),…
Q: Match the molecules (List 2) with the cell structures in which they are involved (List 1). A cell…
A: The study of cell structure and function is known as cytology. Cytology is also known as cell…
Q: What is the function of DNA helicase in DNA replication? to create an RNA primer to initiate DNA…
A: DNA polymerase plays a key role in new DNA synthesis. In eukaryotes, DNA polymerases can be…
Q: To find: The artery that carries oxygen-poor blood.
A: The blood vessels carry blood in the human body. There are three types of blood vessels - 1.…
Q: Which of the following is false? a. Stems have vascular bundles, and roots have vascular cylinders.…
A: Botany, often known as plant science, plant biology, or phytology, is a discipline of biology that…
Q: b) Use the DNA sequence below to answer the following questions. 3'- TACGAACGAGTGCCCCAAAATT -5' What…
A: The process of converting DNA instructions into proteins is known as the central Dogma.
Q: .Capsule does not take any stain
A: The questions are analysed and the options are correctly found and noted.
Q: Set 3: Mutagens _51) breaks the sugar-phosphate backbone of DNA A) ultraviolet light 52) cause…
A:
Q: Labs 3 & 4- Enzymes Can you predict the color of a solution (how it looks to our eyes) given an…
A: Please follow step 2 for detailed explanation.
Q: In confocal microscopy, what is the theoretical resolving power of the objective used (63X, NA 1.3,…
A: Resolving power signifies the smallest distance between two separate points of an object, when…
Q: Indicate the average direction of change (increase, decrease, or no change) observed between 1850…
A: When there is long term change or shift in temperature or weather patterns , then it is called as…
Q: 4. causes oxygen starvation CARBON DIOXIDE CONCENTRATION TESTIFYING TO AIR POLLUTION BY…
A: Anthropogenic contamination is a form of pollution. produced directly by human activities, such as…
Q: The ability to taste the compound PTC is controlled by a dominant allele T, while individuals…
A: A trait is a characteristic features that is exhibited by particular individual . As per the…
Q: Which is NOT true of eukaryotic cells? A) A true nucleus contains the DNA in the form of…
A:
Q: Which stage of mitosis is shown in the picture? Prophase Telophase Metaphase Anaphase
A: Mitosis is equational division. Meiosis is reductional division.
Q: A review of the phylogenetic tree shows a common ancestor for these vertebrates. Which statement…
A: Phylogenetic tree of vertebrates showing common ancestor.
Q: Suppose you are researching a new protein and find that the shape of the protein yields little…
A: Suppose you are researching a new protein and find that the shape of protein yields little…
Q: Lab 10- PCR For the following equipment, know what it looks like, its name, and its function:…
A: 1) A micropipette is a laboratory instrument used to accurately and precisely transfer volumes…
Q: What taxa employs each of these modes of reproduction: 1. Recombinational 2. Primordial 3. Typical…
A: Reproduction: The process of production of new offspring from the parental ones is termed…
Q: Urinalysis Lab If you find 20 colonies on a urine plate, you used a 5uL loop, what will be the…
A: In processing urine samples for culture, instead of making dilutions in the traditional way, the…
Q: How do the skin, gastrointestinal tract, and respiratory system provide defenses against invading…
A: INTRODUCTION The body's most fundamental kind of nonspecific defence is physical defence. Physical…
Q: THE LOWEST BACTERIAL AIR POLLUTION ARE EXPOSED 1. Junior nurses 2. pharmacists-technologists 3.…
A: Junior nurses are basically more often exposed to bacterial pollution as they have direct contact…
Q: In a couple paragraphs, describe the connection and correlation between the red-shouldered hawk, the…
A: Introduction A statistical approach for determining the relationship between quantitative and…
Q: malaria
A: Malaria : Malaria is an infection caused by a few plasmodium species which are single celled…
Q: A C 18. What kind of potentials can be created at the arrow for A? a. Post-synaptic excitatory…
A: Neurons, also known as nerve cells, send and receive signals from your brain. While neurons have a…
Q: Match each vitamin with the correct deficiency or toxicity condition or symptoms Vitamin C [Choose]…
A:
Q: The activity of lateral meristems_____ older roots and stems. a. lengthens b. thickens c. both a and…
A: * The answer of the question is option b that is thicken. * The activity of lateral meristems…
Q: To examine: Whether the statement “Some heart cells and kidney cells secrete hormones" is true or…
A: Hormones are a type of signalling molecule produced by glands and transported throughout the body by…
Q: All of the following are underlying causes of tropical deforestation EXCEPT: Question 24 options: -…
A: Please follow step 2 for detailed explanation.
Q: Explain the steps involved in translocation of sucrose.
A: Xylem and phloem are the vascular tissues present in the vascular plants.
Q: DNA is composed of .which are attached to each other by bonds. O A) nucleotides. phosphodiester O B)…
A: DNA or Deoxyribonucleic acid is the genetic material in humans. It was discovered as a double helix…
Q: Is Bacillus cereus pathogenic?
A: Bacillus Cereus bacteria commensal or pathogenic to foods
Q: People who believe that wild plants and animals have an inherent right to exist believe that species…
A: Q. People who believe that wild plants and animals have an inherent right to exist believe that…
Q: A good number of snail population in the stagnant waters between rice paddies is growing under…
A: Population Density: The total concentration of individuals of a species within the same geographic…
Q: Referring to the figure, what bases will be added to the primer as DNA replication proceeds? 5'[a]3'…
A: In a DNA molecule, the bases on the opposite strands are paired complementary to each other. A…
Q: When the inspiratory neurons of the ventral respiratory group are actvated, impulses travel along…
A: The diaphragm contracts and deflates upon inhalation, while the chest cavity expands. A vacuum is…
Q: Prove if the statement is TRUE or False with complete solution. At a dilution factor of,…
A: Data on colonies grown after plating pasteurised milk samples is provided. Because each cell…
Step by step
Solved in 3 steps
- The steps to convert chaulmoogra oil into an injectable treatment are: I. extraction II. saponification III. hydration IV. acidification V. esterificationIn sterilization, which among the supplies, instruments, glassware, etc. under the list of materials can be sterilized using either or both equipment below? List them down. For "autoclaving" For Dry heat oven Can be sterilized only sterilization with either Materials: 200-ml Erlenmeyer flask Stove 500-ml Erlenmeyer flask Autoclave 10-ml graduated cylinder Analytical balance 100-ml graduated cylinder pH meter Spatula Stirring rod 100-ml beaker Test tubes Distilled water Petri dish Stirring rod Alcohol lamp Glass dropperAside from application of heat, name other methods of sterilization and give examples of materials sterilized in each method
- Which of the following terms is an absolute condition? Degermation Disinfection O Sanitization O SterilizationIn pharmaceutical companies, Sterilization is an important step for quality assurance and approval of pharmaceutical products. Based on this concept, answer the following questions. Heat sensitive liquids need special methods for sterilization. Explain the methods applied in details.Alternative name for Moist-heat sterilization Select one: Oven sterilization Autoclaving Ionizing radiation
- Disinfectants and Sterilization Procedures Complete the table by putting (+) for growth of microorganisms or (–) absence of growth of microorganisms. Disinfectant Concentration Growth after time of exposure (minutes) Control 5 minutes 10 minutes 15 minutes Sodium hypochlorite 5% Sodium hypochlorite 0.05% Alcohol 70% Alcohol 40% Iodophor (Betadine) 10% solution Mouthwash Cetylpyridinium Chloride - 0.075% Sodium Fluoride - 0.05%Examine the given sets of table below. Which disinfectant is the MOST recommended? Support and Justify your answer. Table 2. Phenol Coefficient of Test Disinfectant Name of disinfectant Growth after 5 minutes Dettol Phenol Name of disinfectant Z-germicSide Phenol Dilution 1:100 1:125 1:150 1:175 1:200 1:95 1:100 1:105 1:110 1:115 Dilution 1:100 1:125 1:150 1:175 1:200 1:95 1:100 1:105 1:110 1:115 - + + + + * + Growth after 5 mins + + + Growth after 10 minutes + + + + Growth after 10 minutes + + * Growth after 15 minutes + + + + + Growth after 15 mins + P .. + 9. + + +Which physical or chemical agent would be the best choice for sterilizing the following items: glass pipettes, tryptic soy broth tubes, nutrient agar, antibiotic solution, interior of a biological safety cabinet, wrapped package of plastic Petri plates? Explain your choices.
- Suspend 28.0 grams in the 1000 mL distilled water. Heat to boiling to dissolve the medium completely. Sterilize by autoclaving at 15 lbs pressure (1210C) for 15 minutes. Cool to 45-500C. If desired the medium can be enriched with 5-10% blood or other biological fluids. Mix well and pour into sterile Petri dishes. 1. Determine the amount of dehydrated medium needed to prepare 50 nutrient agar plates. Include amount for 2 additional plates as excess to compensate for compounding losses.What is the difference between a disinfectant and an antiseptic? Which is most effective at removing microbes from a product: sanitization, degerming, or sterilization? ExplainSterilization/Disinfection by Chemical