What are the 3 most important organelle in Plant cell? Why they are essential? — What are the 3 most important organelle in Animal cell? Why they are essential?
Q: Listen Spontaneous Mutations Can result from an error in the egg or sperm of a parent O Can result…
A: Spontaneous Mutations can result from an error in the egg or the sperm of a parent. Spontaneous…
Q: TAIL LENGTH NUMBER OF MICE
A: Introduction: Directional selection When an extreme phenotype is preferred over the mean trait, this…
Q: An isotope of sodium (Na) has a mass number of 22. How many neutrons does it have?a. 11b. 12c. 22d.…
A: Isotopes are members of a family of an element that all have the same number of protons but…
Q: An example of a monosaccharide is ________. a. fructose b. glucose c. galactose d. all of the above
A: Introduction Biomolecules such as carbohydrates, lipids, proteins, etc. are essential for sustaining…
Q: Compare slides #8, #10, and #12 of the spinal cord cross section. What characteristics stand out the…
A: The brain is the main part of the body. It is a part of the nervous system which is the command…
Q: explain how the biochemical structure of DNA allows it to function as the genetic materia
A: Introduction: Deoxyribonucleic acid, or DNA, is a molecule that provides the genetic instructions…
Q: cell
A: In humans, the largest cell is ovum ,the human egg The smallest human cell is sperm cell. The…
Q: Choose the correct answer. The primer bind the 16S TDNA in one of its conserved / variable regions.
A: 16S ribosomal RNA is composed of RNA of the 30S subunit of a prokaryotic ribosome. They have two…
Q: How many grams of media would be required to prepare 350 plates assuming 20 mL per plate? O 72 O 112…
A: The preparation of mentioned Escherichia coli culture media contain 36 grams per litre deionized…
Q: Identify either a specific form of cancer. Describe some details about the cancer.
A: Introduction Cancer is defined as uncontrollable growth of cells resulting in the formation of cell…
Q: The type of logical thinking that uses related observations to arrive at a general conclusion is…
A: The process of analysing an issue & coming up with a reasonable answer can also be described as…
Q: Describe the incidence and types of child maltreatment or abuse.
A: Maltreatment is the word that tells the quality of care any child receives while the word abuse is…
Q: A) Discuss THREE properties of water B) Explain each of the following in terms of the properties of…
A: Introduction Water is a excellent solvent. Water molecule (H2O) contains two H atoms and one oxygen…
Q: If the line 3 butterflies are crossed with the line 5 butterflies and they produce all extra-long…
A: During the genetic crossing, the parents give rise to their offspring. The offsprings have a…
Q: Relationship of each unit to the base unit In the metric system, the the base unit. Multiple Choice…
A: Introduction In biology, the most commonly used SI base units are second (s), meter (m), mole (mol),…
Q: create a question about animal physiology thermogenesis that shows you understand the topic to ask…
A: Introduction Endotherm is the term used to define organisms that are capable of controlling or…
Q: 4. What is mitrochondria?
A: We know that Cell is the basic functional and structural unit of every organism and is further…
Q: Problem B. DNA: Codon Segmenting The way that DNA is often interpreted as genes is in groups of…
A: An open reading frame (ORF) is the segment of DNA (deoxyribonucleic acid) sequence that can be…
Q: The ___________ is the basic unit of life.a. organism b. cellc. tissued. organ
A: All the living organisms are made up of cells which forms the basic unit of life.
Q: What is fuels
A: Fuels are materials that can be either solid, liquid, or gas. There are many types of fuels that can…
Q: Can you think of one organism not mentioned in this chapter as a keystone species that you believe…
A: Introduction An ecosystem deals with both biotic and abiotic factors and their interaction with each…
Q: Meniscus The meniscus is Multiple Choice O о о None of the answer choices are correct. film of water…
A: ANSWER) Meniscus is formed by the molecules of water in the container which are in contact with the…
Q: R8
A: We know that Hormones are defined as the type of signaling molecules that are directly secreted into…
Q: Which of the following sequences represents the hierarchy of biological organization from the most…
A: Biological hierarchy refers to the systemic organisation of organisms into each levels, such as the…
Q: Describe the two layers of the skin.
A: Skin is the largest external organ of our body that forms a external protective layer and protects…
Q: Argumentative essay on evolution and creation
A: For many years, there has been a heated debate between creationism as well as the study of…
Q: evilsgon a en boensd nas odsoulg 4. Approximately 10% of people living in the United States are…
A: Scientific control is a methodology that tests integrity in experiments by isolating variables as…
Q: 17. In the last 8 weeks of gestation, extramedullary hematopoiesis is most likely to occur in which…
A: Introduction The haematopoiesis is the process of formation of components of blood in the bone…
Q: Question 2: Calculate the Mid-Parent, Better Parent and Economic heterosis for plant height from the…
A: Heterosis, also called outbreeding enhancement or hybrid vigour, is the improvement of function or a…
Q: draw the products of meiosis (gametes) produced by Alignment C.
A: The indirect process of cell division in which the chromosomes of parent cells divide once but…
Q: What steps are necessary and unnecessary for non-protein coding genes?
A: The translation is the process of analyzing the mRNA message in order to produce a protein. It is…
Q: is a substance secreted by cells in the lungs that reduces surface tension.
A: Introduction :- The lungs are two air-filled, spongy organs that are situated on either side of the…
Q: What is the relevance of amphioxus in studying anatomy of vertebrates?
A: The closest living invertebrate relative of vertebrates is the cephalochordate amphioxus…
Q: List the secretions of the pancreas, liver, and gallbladder.
A: Digestive secretions are the digestive fluids and cells and mucus that line the gastrointestinal…
Q: What risk factors and clinical findings are associated with pyelonephritis?
A: An unexpected and serious kidney infection is known as acute pyelonephritis. The swelling it…
Q: In the weight exercise, the tare button was used to Multiple Choice O stabilize the scale. record…
A: In the weight exercise, the tare button was used to reset the scale.
Q: During pregnancy, FSH and LH levels should be: High- progesterone stimulates the release of FSH and…
A: Hormones are proteins that control various functions in the body. Progesterone, estrogen, follicle…
Q: Put the following hierarchical levels in the correct order representing the structured organization…
A: Introduction The level of organization of biological refers to the complexity of the various…
Q: Surface plasmon resonance is caused by, and the event is exclusive to, respectively-
A: Surface plasmon resonance is the method used to measure the adsorption of materials. This is done on…
Q: 1. Organelles work together to sustain the overall function of the cell and maintain homeostasis…
A: 1. Each organelle perform specific function, which co-ordinate with different organelles to make the…
Q: Record which pole the dyes traveled to by using a (+) for positive and (-) for negative pole.
A: Various dyes are used to stain cells and tissues for increasing resolution and improve…
Q: Instrument used to weigh objects in the metric system lab What instrument did you use to weigh…
A: The International System of Units (SI) is a more accurate version that is used by researchers in…
Q: Lungs contain more elastic fibers than collagen fibers.
A:
Q: During pregnancy, FSH and LH levels should be: High-progesterone stimulates the release of FSH and…
A: Introduction Changes in immunological function, energy storage, blood volume, and hormone synthesis…
Q: Figure 1.18 In the example below, the scientific method is used to solve an everyday problem. Which…
A: To characterise the structural aspects of the world, scientists perform observations and tests.…
Q: Pls help if u can, sorry for the trouble Relate these terms in a single sentence: cells, organs,…
A: Introduction The fundamental and basic units of all living things are cells. There are many billions…
Q: each of these 5 tissues and color the images using the legend/colors: the nucleus (blue), Cytoplasm…
A: Introduction The cell is the basic, structural, and functional unit of life in all biological…
Q: Are there any other modes of nutrition? What are these and how relevant is it to that particular…
A: All living organisms require food. The food gives energy to the organisms for growth and maintenance…
Step by step
Solved in 3 steps
- Note : — don't copy in google or bartleby. Plagarize checker will be used. QUESTION : In Tabular form, summarize the similarities and differences in the different movements across cell membrane.Note : — don't copy in google or bartleby. Plagarize checker will be used. QUESTION : — Why is it necessary for a mitochondrion to have many infoldings ? — What will happen if mitochondrion has few to no infoldings at all ?orelearning.com/index.cfm?method%3DcResource.dspView&ResourcelD=D450&ClassID=D49 4. In what cellular function does the structure shown here play a role? O A. They play a major role in protein synthesis. O B. They act as the powerhouse for the cell. O C. They are involved in the separation of chromosomes during cell division. O D. They are inyolved in photosynthesis.
- please choose correct letter and explain a bit 1. The strongest way by which a protein can maintain its shape is by using:a) ionic bonds b) disulfide bonds c) star war forces d) van der Waals forces 2. If a cell (like an amoeba) would be capable of migrating from one place to another only with movement created from the inside of the cell, then we can say that that movement is done mainly by: a) glycoproteins b) feet c) microtubules d) actin filaments True or False: In eukaryotic cells (such as human cells), the variety and diversity of proteins is much less than the variety and diversity of lipids.Cell Graphic Organizer Please complete the following graphic organizers to the best of your ability. • FIRST SQUARE: Put each component's function in the first square. The function is what the component does in the cell. Please be very detailed in your answer and use your book to help you. SECOND SQUARE: In the second square, please put the type of cell that the component is found in. Although you could talk about prokaryotes vs. Eukaryotes, it would be more important to talk about plant vs. animal cells. Also, if possible, please describe where in the cell this component is found. THIRD SQUARE: In the third square, please make a sketch of the component. Although we are not all gifted artists, please give this a good attempt. You may want to show where it is in the cell, an inside view of the part, or even a combination of both. • FOURTH SQUARE: Finally, relate the function of the cellular component to something at FHS. Make sure that the connection is clear and well described.Cell Graphic Organizer Please complete the following graphic organizers to the best of your ability. • FIRST SQUARE: Put each component's function in the first square. The function is what the component does in the cell. Please be very detailed in your answer and use your book to help you. SECOND SQUARE: In the second square, please put the type of cell that the component is found in. Although you could talk about prokaryotes vs. Eukaryotes, it would be more important to talk about plant vs. animal cells. Also, if possible, please describe where in the cell this component is found. THIRD SQUARE: In the third square, please make a sketch of the component. Although we are not all gifted artists, please give this a good attempt. You may want to show where it is in the cell, an inside view of the part, or even a combination of both. •FOURTH SQUARE: Finally, relate the function of the cellular component to something at FHS. Make sure that the connection is clear and well described.
- Please help: Question: Protein structure is central to our understanding biological systems. The tubular proteins that make up the cytoskeleton of the Amoeba are an example of complex Protein structure. Consider the following for the Amoeba and how it reacts to the outside world. Name the four levels of protein structure: How are these structural characteristics developed in the Endomembrane system of an Amoeba cell. Reminder, the endomembrane system includes the nucleus. How do the levels of protein structure explain the movement of the amoeba toward a stimulus.Note : — don't copy in google or bartleby. Plagarize checker will be used. QUESTION : How does flagella and cilia differ in movement and other structures ?Tabular: 1. Give the chemical composition of each organelle in the animal cells and plant cell 2. Give the function of each organelle in the animal cell and plant cell.
- From what organelle is this DNA isolated? ATCACGAGCTTAATTACCATGCCGCGTGAAACCAGCAACC Use BLAST to discover what the genus and species is and read the description of the first organism that is listed. mitochondrion chloroplast ribosome nucleusWhat type of micrograph is shown below? Is the organism pictured prokaryotic or eukaryotic? How can you tell?Based on your microscopic observation, how many individual cell thus the string is comprised of? What is approximate combine cell length of the cells? Remember: Always measure the cell length base on the widest/longest midsection of the cell!