Q: ve the appгоpпа of the enzyme ihat calalyzes ach of trNe eactions? CH, – C – H II a.CH, CH,OH + На…
A: Enzymes can be defined as the biological catalyst that does not participate in the reaction but…
Q: Via Siiple uim least readily). H3N-CH-c-o CH2 nd CH2 CH2 CH2 NH3 #2 because of the Charges…
A: The internal composition of the cell is maintained because the plasma membrane is a selectively…
Q: Mr. Steve is 25 years old, caucasian, and physically fit. He wanted to travel alone before pursuing…
A: -Diarrhea: This is a very common problem. This problem includes the symptoms: — loose stool,…
Q: A function production X of the structure labelled X is the of: ICC
A: Introduction The digestive system starts from the mouth and ends in the anus. It includes various…
Q: In globins oxygen binds to... Question 37 options: Fe3+ Nitrogen atoms Fe2+ Th…
A: The myoglobin contains a single polypeptide and a single heme group. The hemoglobin acts as the…
Q: (NH2)2NO(aq) 2 H*(aq) H2O(I) → 2 NH4*(aq) NO2(g) + Property that Changes How It Changes with Time
A: NO2- state changes from aqueous to NO2 in the gaseous state. Nitrogen dioxide is a gas when produced…
Q: Show anabolism of two molecules of serine. Be sure to clearly identify each molecule and…
A: Anabolism is the synthesis of complex molecules from simpler ones.
Q: Which of the following CHÍNH, CH HO CHÁNH, CH₂OH I CH H₂N both a and b neither a nor b CHÍNH
A: Stereochemistry is also known as the subdiscipline of the chemistry. Stereochemistry involves the…
Q: A. Basic R group B. Aromatic R group C. Acidic R group D. AliphaticR group
A: Amino acids are the structural unit of the proteins. Amino acids are joined by a peptide bond to…
Q: Which of the following is not found in DNA?a. thymineb. phosphatec. cytosined. deoxyribosee. uracil
A: Bothribonucleic acid (RNA) and deoxyribonucleic acid (DNA) are composed of nucleotides. And a…
Q: At pH=2.2, which of the following is true СООН ÇO0 Ç00 CO0 H,N-CH H3N-CH H,N-CH H2N-CH CH2 pK, CH2…
A: The given amino acid is glutamic acid. Glutamic acid is an acidic or negatively charged amino acid.…
Q: The following is an image of: H2N ОН ОН
A: The chemical structure presented above contains three components that are the Nitrogenous base which…
Q: Sele ar neubral 6 positivedy et negabveiy d. Cationic ei anioni c Need answer on
A: Amino acids Proteins are the polymers of nitrogenous compounds called amino acids. Each amino acid…
Q: This picture shows a [ Select ] v and its specific name is [ Select ] It pairs to [Select ) and…
A: DNA is the genetic element in all cell types of prokaryotic and eukaryotic. DNA is double stranded…
Q: Without oxygen, 1) pH will increase O2) cells become more basic 3) proteins may change structure
A: PH will increase
Q: Glycoproteins on the surface of the cell membrane is what gives a cell it's identity O True O False
A: Proteins associated with carbohydrates or sugar residues are known as glycoproteins. The process of…
Q: Which of the carbon atoms in the following structure is likely to be the least susceptible to…
A: Cytochrome P450 consists of heme as a prosthetic group. Cytochrome P450 is an oxidase enzyme. It is…
Q: Choose from A-F. This amino acid may serve as a phosphorylation site, and turn on or off the…
A: Protein phosphorylation is a type of protein regulation called a reverse covalent modification. The…
Q: MULTIPLE CHOICE Which of the following nucleotides are found in RNA? Select all that apply. A…
A: Given: Nucleic acid is composed of nitrogenous bases, pentose sugar and phosphates. DNA and RNA are…
Q: Refer to image below: Which group is acidic? * H. H N-Č- D A H' H. Choose A hich pair will have an…
A: The structure shown in the figure is of the amino acid glycine. The general structure of amino acid…
Q: Just answer the last column which is only the name and structure of the given Sphingolipid.
A:
Q: Bears are made of gelatin, starch, and sugar. Gelatin is a polym repeating units) that forms large…
A: When the gummy bears are submerged in water for 24 hours, the gummy bears will swell by absorbing…
Q: Conjugated proteins which are a combination of amino acids and carbohydrates O A. nucleoproteins OB.…
A: Based on the composition, proteins are of two types, simple and conjugated proteins. The simple…
Q: How would you make a cup of coffee using this coffee beans? Explain your answer.
A: Coffee beans Coffee beans are the seeds of coffee plants that are used to make coffee from it. It is…
Q: Which of the following does NOT contain 1,4 glycosidic linkage? వార్ CH,OH CH,OH CH;OH CHOH о он HO…
A: Glycosidic linkage refers to C-O-C linkage between two carbon atoms of different monosaccharide…
Q: ECF a2+ Na+ Odorant CAMP CAMP АТР Cytosol The G-protein is labeled O A O D Submit Request Answer
A: The cells are communicating with each other by cell signalling process. Different signalling…
Q: = x This biomolecule is typically used as a source of energy for cellular respiration. А -О ОН ор -о…
A: Biological macromolecules are the molecules that are needed in enough amount for the body.…
Q: Average net charge of +2 predominates: а. b. The predominant species is…
A: Since we only answer up to 3 sub-parts, we’ll answer the first 3. Please resubmit the question and…
Q: Save water
A: Life evolved in water. The major cellular component of organisms is water. It is needed for all…
Q: abel the following on the graph: C 1000 10000 Percent Effect
A: Partial agonists are ligands that bind to the agonist recognition site but produce a weaker response…
Q: handwritten solution of both parts
A: 1. C Insulin's activities on glucose take-up are prevalently intervened by GLUT 4, which is found in…
Q: The y-axis of a Michaelis-Menten plot has units of M/s (or similiar). Think about why this is. Now…
A: Michaelis Meten plot determines the different parameters of enzyme kinetics such as Vmax and Km,…
Q: Consider the following molecule. a. Name it.b. Use the three-letter symbols for the amino acids…
A: Amino acids are organic compounds that contain the amino (–NH2) and carboxylic acid (–COOH)…
Q: Define the following terms:a. radicalb. ROSc. RNSd. GSHe. SOD
A: Hello. Since your question has multiple sub-parts, we will solve the first three sub-parts for you.…
Q: Which of the following 1-C unit:carrier pairing is/are correct? a.biotin:C02 b.THF:-CH2-…
A: Biotin is a co-factor that carries CO2 and regulates the activities of enzymes like acetyl-CoA…
Q: CHOSE ONE ANSWER FROM EACH GAP PEI is a ____(POSITVE,NEGATIVE,NEUTRAL)________charged polyamine…
A: Following statement is filled with suitable response.
Q: Look at the structure shown below and answer the following questions: HN NH но NH Download image. a.…
A: Peptides or proteins are composed of twenty standard amino acids attached together via peptide…
Q: Protein synthesis is also known as Blank 1 Blank 1 Add your answer
A: Introduction Organisms are made up of proteins. Proteins have a high nutritional value and are…
Q: which of these are polar? CH3-CHCl2, CH2Cl-CH2Cl OR BOTH
A: Molecules are made up of atoms. The net charge of the molecule depends on the charges of the…
Q: Which type of PAGE would you use for the following? a.Monitoring the hydrolysis of casein in milk by…
A: introduction When proteins are separated by electrophoresis through a gel matrix, smaller proteins…
Q: ons that are suitable in your
A: A questionnaire is a type of research tool that have a collection of questions or other forms of…
Q: Name an example of each of the following classes ofcompounds:a. glycoproteinb. proteoglycanc.…
A: The body consist of various compounds and each one of them play a key role inside are body such as…
Q: Pick the protease inhibitor drug? H2N COOEt H2N O=P-O H;COCHN NH2 CH2 Ph H3C HN- IV
A: Protease inhibitors are a class of drugs that are used to treat or reduce the progression human…
Q: Which methyl groups are from SAM? CH3 CH30 CH3 H3C H3C H3C' COCH3
A: Methylation is the process by which methyl groups (-CH3) are added to biomolecules by replacing a…
Q: Which of those molecules has a primary structure? Select one: a. Tryptophan b. Cholesterol c. t-RNA…
A: t-RNA
Q: Major groove contains much more chemical information than the minor groove has. These molecules…
A: In DNA base pairs are located in a mannered fashion with different bonds. Major and minor grooves…
Q: ___________hemolysis is the partial lysis of red blood cells due to bacterialhemolysins.a. Gamma- c.…
A: Hemolysis is the process of breakdown of blood cells by certain bacterial proteins. This process is…
Q: Instructions: Print out or copy this sheet. Label all structures as appropriate. Draw and label all…
A: E. coli can synthesize the tryptophan by using enzymes that is encoded by 5 structural genes…
Q: Hemoglobin is an enzyme containing amino acids linked by peptide bonds. Select one: True False
A: Introduction : Enzymes are biological macromolecular catalysts. Chemical reactions are accelerated…
Q: The word “atom” comes from the Greek word _____________ which means indivisible.
A: Elements are the atoms which are present in the atmosphere, there are different elements present.…
please help me find the answer
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 2 images
- What exactly does "DFR" stand for?Why the blood is red?HindII --- 5' GTC - GAC 3', HaeIII --- 5' CC - GG 3', EcoRI --- 5' G - AATTC 3' and BamI --- 5' CCTAG - G 3' 5' AGAATTCTTACGCCGGACGTACCTAGGTTTAGTCGACTC CGCCGCCCCTAGGGTCATCA 3' 3' TCTTAAGAATGCGGCCTGCATGGATCCAAATCAGCTGAGGCGGCGGGGATCCCAGTAGT 5' Number of pieces of DNA , and blunt end fragment (s), and sticky end fragment(s)
- Name this?can someone help me with labeling this :)Page 1: Second Letter C 1 2 UUU U UUC UUA Phe UCU UCC UCA UCG UAU UAC UAA UAG UGU Cys U UGC Stop UGA Stop UGG Tyr -- Ser Leu Stop A Trp G UUG CUU C CUC CCU Leu cc CAU His CGU Pro CAC CGC Arg CUA CUG CCA CCG 1st СА Gln CGA CAG CG 3rd letter AUU A AUC AUA AUG ACU ACC ACA AGU Ser AGC u letter AAU AAC AAA AAG Asn He Thr AGA AGG A Arg G Lys Met ACG GUU G GUC GUA GUG GCU GCC GAU Asp GGU GGC U Val GAC GAA GAG Ala Gly GCA GGA GGG Glu GCG 1. Convert the sequence from DNA to Amino Acids. 3-TCACCACTCTGGTCTGGTCATATCTGCCTGATATGAGTACAT - 5' a. direct transcript? b. transcript for translation? c. direction of a? (3' to 5' or 5' to 3') d. direction of a (3' to 5' or 5' to 3') e. translated peptides?