What does the following picture represent? ೪೫ ೮೨ 8 2 3 ಸಿಹಿ ೧ 13 888 19 20 8 ಹ 15 O male karyotype O female karyotype O trisomy 21 ಕಿರಿ ಕಿರಿ 4 5 10 11 12 - 18 KG JA 16 17 18 dA ka 21 22 not a human karyotype

Q: A child is born with a rare disease in which mitochondria are missing from certain skeletal muscle…

A: The Mitochondria's  main job is to produce ATP, which is the product of a process known as cellular…

Q: At the end of the chromatography process you observe that the developing solution is bright green.…

A: Chromatography is a common laboratory technique for separating and analysing mixture components. It…

Q: How can turbidity relate to the concentration of microbes present in a sample?

A: Turbidity is a measure of how cloudy or clear a liquid is. It is caused by the presence of suspended…

Q: The phylum Chordata only contains vertebrate species.   Question 4 options:   True   False The…

A: The animals are classified under the kingdom Animalia. This kingdom is further divided into multiple…

Q: If you had additional hearts distributed throughout your body, what would be one likely advantage…

A: The circulatory system would be altered if humans consists of many hearts distributed throughout…

Q: The taste, smell, and presentation of food have a ___________ influence on food digestion. A.…

A: Taste and smell are chemical senses. These have sensory receptors that give response to food…

Q: If a SNP is found much more frequently in dogs with white fur than in dogs with black fur, the SNP…

A: Single nucleotide polymorphisms (SNPs) in GWAS are essential for understanding the genetic…

Q: Create an experiment that will cause DNA to mutate. If only frameshift mutation occurs, explain and…

A: Mutations are well stated to define that they are used to refer to changes or alterations that occur…

Q: B 5. What is happening on this petri dish? Label the following on the picture below: 1) Bacterial…

A: Microorganisms are microscopic structures that cannot be seen as such through naked eyes but require…

Q: • Explain what is happening here in muscle contraction. Be sure to tell me what role Ca+, ATP,…

A: There are three types of muscles present in our body, namely skeletal muscle, smooth muscle and…

Q: For what purpose is mitochondrial genomics used?   Question 20 options:   Forensic analysis…

A: Mitochondria - Mitochondria are organelles found in the cells of most eukaryotic organisms,…

Q: Why are biologic systems such as red blood cells and guppies susceptible to osmotic injury? They are…

A: Osmotic injury is the osmotic shock or osmotic stress. This is special type of physiological…

Q: When blood calcium is high, the thyroid releases [Select] , and less [Select] [Select] kidneys.…

A: To answer the question accurately, you need to be familiar with the following concepts:1. When blood…

Q: A ______ describes a site of crossing over.     centromere     synapse     histone     chiasma

A: Cell division known as meiosis occurs when a parent cell divides into two daughter cells, each of…

Q: If a codon found in the mRNA sequence Tessa CGA, the tRNA anticodon that would bind to that codon…

A: In protein synthesis, the mRNA sequence is read in codons, or sets of three bases. These mRNA codons…

Q: You have several mutant strains of virions. Describe the replication cycle and outcome for each…

A: Understanding the life cycle of a virus, and how mutations can influence each stage, is fundamental…

Q: what are some questions regarding the Rainbow papaya (Carica papaya)? Give two interesting facts…

A: The Rainbow papaya, also known as the Rainbow Solo or SunUp, is a genetically modified (GM) papaya…

Q: Based on this information, what type of enzyme would ornithine decarboxylase be? I searched it up on…

A: In the study of enzymology, the classification of enzymes is based on their specific functions and…

Q: What is the function of polymerase 2? To work on the repairing the DNA created. To only work on the…

A: DNA carries the genetic information of the organism stored within the nucleus and also plays a role…

Q: Review the discussion of evolution and the Investigating Life feature. Which of the following…

A: Moth collect mainly the orchid nectar as food. The orchid nectar helps in nutrition of moth. So it…

Q: During telophase ______.     chromosomes line up in the middle of the cell     the events of…

A: Cell division or cell cycle is the process through which a cell matures and divides after a sequence…

Q: What are the anatomical changes that allow bipedalism?

A: The anatomical changes that allow bipedalism can be categorized into two major steps: the evolution…

Q: In insectivorous plants, what part or parts of the plants evolved to make them insectivorous…

A: Insectivorous plants are carnivorous plants. Insectivorous plants are insect-eating and they get…

Q: Suitable hypothesis that will predict answers for the following: A) what is the rate of germinating…

A: An explanation or claim that is put forth as the foundation for more research or testing is called a…

Q: Which of the following is not a characteristic of life? O All living organisms are multicellular.…

A: Life, in its myriad forms, is a fascinating study of complex and diverse mechanisms and attributes.…

Q: Give only typing answer with explanation and conclusion What is the final concentration, as a ratio…

A: Medication is commonly administered in medical settings by diluting it in a solution, such as normal…

Q: For the guy micro biome Find a recent (2015 or newer) primary research article that investigates…

A: Gut microbiome are the collection of all microbes, they are like bacteria, virus and also their…

Q: Match the types of bonds to their definitions. lonic Bond Polar Covalent Bond Nonpolar Covalent Bond…

A: The ability of an atom to draw electrons into a chemical connection is known as electronegativity.…

Q: Based on the data shown where is the DNA binding domain?  Explain which constructs helped you reach…

A: The given scenario involves the study of a reporter-gene construct containing a lacZ reporter gene…

Q: Describe the basic pathway of information flow through neurons that causes you to turn your head…

A: Nervous system in the human body involves in coordination and control various types of activites.…

Q: Could you provide a rundown of the numerous infections and their consequences?

A: Infections are a common occurrence in the realm of human health, caused by a wide range of…

Q: 2. which would be more accurate in terms of determining numbers of viable bacterial cells in a…

A: “Since you have posted multiple questions, we will provide the solution only to the first question…

Q: 11-1 Family 1 1-1 11-2 1-2 11-3 III-1 III-2 Family 2 1-3 11-4 111-3 1-4 11-5 III-4 111-5

A: The carrier of a disease is the person whom have one copy of a mutated or changed disease causing…

Q: Humans are both     autotrophs and producers.     heterotrophs and consumers.     heterotrophs…

A: The numerous means by which organisms receive the fuel and nutrients necessary for their existence,…

Q: some structure and functions related in animals. needing a few examples

A: The animal kingdom is a remarkable tapestry of life, comprising an astounding diversity of species.…

Q: DNA sequence A: 5' - 3' TAACTTAAGGCCAATCGAAATCTTAAGGCGGTATACGCGTTAACCTTAAGG 3' DNA sequence B: 5'…

A: Restriction enzymes are restriction endonucleases that have specific restriction sites and…

Q: Suppose you have subjected the two given samples of EcoRl digested DNA to get electrophoresis. Draw…

A: Gel electrophoresis is a separation technique where fragments of DNA are separated on the basis of…

Q: How is mitosis different from meiosis in terms of the resulting daughter cells? list 2.  What is…

A: In eukaryotes, there are basically two types of cell divisions which are mitosis and meiosis.…

Q: The Biofuels industry is interested in engineering bacteria so that they may produce fuels such as…

A: A protein known as σS (sigma S) or RpoS (RNA polymerase sigma factor S) is encoded by the rpoS gene.…

Q: MUTATION-BASE SUBSTITUTION Change the 14th base of the DNA to guanine "G". Construct a new, mutated…

A: Q.Ans:- A mutation is an event where the DNA sequence gets changed as a result different types of…

Q: ws the dark pigment nin to be produced in a her, displaying complete inance. een Phenotype depends…

A: A gene is made up of two alternative alleles. These alleles can either be present in homozygous…

Q: In an experiment, the smaller the sample size, the more credible the results of the study. A) True…

A: "Male pattern baldness is a common condition that affects millions of men worldwide. The quest for…

Q: Diabetes insipidus:*   a. Hypernatremia due to decreased water intake b. Hypernatremia due to excess…

A: Diabetes insipidus is a disorder that occurs when there are low levels of ADH (Antidiuretic hormone)…

Q: Explain what is going on at sites A, B, C, D, F and G in relation to CHARGE (negative, positive,…

A: Action potentials are electrical impulses that neurons use to interact with one another. The…

Q: It took 25 minutes to kill all the bacteria in a test tube at a temperature of 135 degrees Celsius.…

A: An autoclave is a device that uses high pressure and temperature to sterilize equipment and…

Q: Human muscle cells use lactic acid fermentation to      produce ATP without O2.     regenerate…

A: Human muscle cells use lactic acid fermentation to:produce ATP without O2.During intense physical…

Q: This clinical trial occurs after a drug is approved for widespread use.

A: After a drug is approved and made available to the general population, Phase IV trials, also known…

Q: People with unhealthy weight issues should fast to unlock a healthy body. How does fasting affect…

A: Fasting can have both positive and negative effects on individuals, including those with unhealthy…

Q: FILL IN THE BLANK A 'wild-type' allele is the allele that is most common in a population, and that…

A: The term "allele" is used to refer to a gene's alternate form or variants. For every autosomal gene,…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.