WHAT IS IT? Drag the label to each picture. Is the picture a consumer, producer, or decomposer? decomposer consumer producer producer producer producer consumer producer consumer decomposer
Q: What is the best analogy for the nucleus's job? Transport company Construction site Storage tanks…
A: Cell is a structural and functional unit of living organisms. Several cells joined together to form…
Q: DDT is a persistent environmental pollutant once widely used as an insecticide. Using solubility…
A: DDT, which is the abbreviation of dichlorodiphenyltrichloroethane, is an insecticide that is added…
Q: What are the approaches to waste management? What is municipal solid waste and how to limit it? What…
A: Waste management is a technique of managing the waste / used material starting from its assembling…
Q: Which one below has the highest capability of recovering its initial embodied energy content when…
A: Product is formed when substrates react with each other. Some products have a higher energy level…
Q: Why is algae being grown in wastewater
A: INTRODUCTION Production and emission of CO2 from different sources have caused significant changes…
Q: Which of the following is true of solar cells? Moderate net energy yield Little or no direct…
A: Solar cells, additionally called photovoltaic cells, straightforwardly change energy into…
Q: Preservatives/additives and maintenance of temperature (hot or cold) for prepared food items helps…
A: Introduction:- Food is a substance that is mostly made up of nutrients such as protein,…
Q: The microscope images show two different sludges. Which sludge is preferable in a biological…
A: Bacteria, archaea species, fungi, and certain protists are among the aerobic and anaerobic microbial…
Q: True or false? Original materials are rare.
A: Original materials are pure materials or actual materials.
Q: True or false? All pollutants are synthetic chemicals.
A: The environment is composed of all living and non-living things found in nature. Pollution is the…
Q: (like a cup) is not considered a pollutant
A: Pollution causes adverse changes to the environment by contaminating the land and water from…
Q: Which of the following pairs of words are most clearly opposites? a. biodegradable, recalcitrant b.…
A: Answer is a.) biodegradable ,recalcitrant.
Q: Arrow Blank 1. Fill in the blank, read surrounding text. _____________ indicates cultural…
A: Anthropogenic activities that harm the balance of Earth in the world are of great concern. This…
Q: Imagine a company producing Non-Biodegradable plastic which is polluting the local environment. 1.…
A:
Q: Ted heats some food just to boiling, and stores some of it immediately in a container which he…
A: A microorganism, or organism, is a living being of minute size, which might exist in its…
Q: the rate of the reaction in one direction is equal to the rate in the reverse direction. the…
A: At equilibrium, reaction appears to have stopped, and the total amount of products and reactants…
Q: Discarded trimmings left over from paper production are an example of internal waste external waste…
A: Waste Waste is an unwanted material or a by product obtained in a process which can be reused or…
Q: Write bulleted notes on solutions to the environment
A: Solutions to Environmental Issues Following are some of the most common solutions to the…
Q: Which level most likely represents the autotrophs in the energy pyramid? Support your answer.
A: An energy pyramid or an ecological pyramid represents the flow of energy through the ecosystem…
Q: A food consumer stored their food at 4 degree celsius without washing, hoping to preserve it for a…
A: Refrigeration doesn't kill the bacteria as such but makes their enzymes and metabolism inactive and…
Q: Which statement is supported by the diagram on the right? Pure Water Sodium Chloride in Water Power…
A: In the diagram on right side , their is a sodium chloride in water and bulb glow because they…
Q: You grow cells in the lab in the presence of radioactively labeled oxygen gas. Which cell metabolite…
A: Oxygen is inhaled and is supplied to cells through blood. Oxygen is utilized for metabolism. The…
Q: During the summer, you have learned that the thermal stratification forms in the lake. Please…
A: Thermal stratification occurs in the lakes because of the effect of warmer and intense temperatures…
Q: types
A: Thermosetting plastic is made up of cross-linked chain polymers. Thermoplastics, on the other…
Q: In beer brewing, what is wort? grain starch hops/mash mixture O germinated barley grains strained…
A: Beer brewing is the process of steeping a starch source (commonly cereal grains, the most popular of…
Q: The responsiveness of an organisms growth to a range of environmental temperatures - I need the…
A: Organism growth depends on a range of of temperature.Temperature required for echa species are…
Q: MULTIPLE CHOICE Question 10 Why is water along lakeshores and in rivers more vulnerable to thermal…
A: Thermal pollution Thermal pollution is the change in the temparature of environment from natural…
Q: Why is barely used in brewing
A: Brewing is the process of production of beer through steeping a starch source such as barley in…
Q: 1. Energy is said to flow in a "one-way" stream through an ecosystem. In your own words, describe…
A: Energy is a property of objects that can be moved to different objects or changed over into various…
Q: Explain the difference between a detritus food chain and a grass food chain Please help me!
A: The food chain refers to the flow of biomass through a series of organisms that consume it. A food…
Q: In more than 200 words, explain how recycle helps reduce plastic waste.
A: Plastic pollution, also known as plastic waste, is defined as the buildup of plastic objects such as…
Q: Peat is a compact layered mass of mummified plant detritus that has collected over geological time…
A: Peat is an accumulation of partially decayed vegetation or organic matter. It is used as a fossil…
Q: Which one of the following is the major antioxidant on cell membrane? A. SOD B. Selenium C. Vitamin…
A: Antioxidants are important in removing oxygen radicles from the body. They help avoid cell damage…
Q: How do you think a farmer can best help to conservesoil? How do you think a scientist can best help…
A: Introduction Soil is a very essential component of the earth. The topmost layer of the earth is…
Q: What is the environment impact of coal? Include coal mining, transport, and use What is the…
A: The environment impact of coal Emission of pulverised fuel ash Emission if exhaust gases leads to…
Q: Biochemical oxygen demand (BOD) is a measure of the:
A: BOD gives us an overall idea of the health of the water body by measuring certain parameters such as…
Q: In your environmental science lab, you test water samples from local bodies of water and find high…
A: There are various organisms found in the water bodies The various strains and microbes like…
Q: Of the three sources of energy, natural gas, coal, or nuclear power, which is the most dangerous for…
A: Energy is the ability to do work. Energy can be obtained from diff. sources like wind , oil, water,…
Q: 3. Compare the different energy sources described in this article. Mark with an 'X' to show how each…
A: Answer:- Different sources of energy are used to generate electricity. Some of these sources are…
Q: What is the most likely biosafety level of your introductory microbiology lab classroom?
A: A biosafety level (BSL), also known as a pathogen/protection level, is a set of biocontainment…
Q: Which of the sources listed below is used by heterotrophs? Inorganic molecules for carbon only…
A: Answer 1 : most plants and algae conduct C3 photosynthesis : true. C3 photosynthesis is the…
Q: All Biofuels are made from Select one: O a. Animal fat O b. Corn O C. Plants O d. Biological…
A: Biofuels are environmentally beneficial since they lower the danger of global warming. Using…
Q: What is Environmental Health? What are the effects of toxic substances on organisms? What are the…
A: Environmental Health states the relationship between the environment and people. It promotes the…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Decumentt-Word Product Activation Failed) Insert Design Leyout Raferences Mailings Revien Vie Office Tab Design Legout Helvetica 12 …,市,。 4 Pinces 21 1 AabbCcD AaBbCcD AaB AaBbCe AabB Aanbcer Aalbcen 1 Normal No Spac Heading1 Heading 2 unter A- Pind Fent Tele Subtitle Sutle im. Paragraph Se Styies teng A Hinge joint G. Flexion, Extension, Adduction, Abduction with minimal rotation M trapezkum to base of M1 B. Enarthrosis H. Rotation N. Occipital condyles to superioi articutar tacet of allas C. Condyloid 1. Flexion, Extension O head of humerus to glenoid fossa D. Pvot J. Gliding P. head of proximal phalanx to base of middle phalanx E Saddle K Flexion, Extension, Adduction, Abduction with no rotation Q radial head to radiat notch F. Planar L Flexion, extension Racromion process to acromial end NONAXIAL UNIAXIAL BIAXIAL POLYAXIAL Type of joint 11 2. 3. 4. 5. la Movement a. a. a. b b. b. Example b. 711 pm ENGMarit X K Marit x K Marit x K Marit x K Marit X K Marit x K Marit x K mea X amihq.com/web/viewer.html?state=%7B"ids"%3A%5B"1Pnete_jWal4wBT4oiRDhFTYO4KGTeuMI"%5D%2C"action"%3A"op P A Kami Schoolo. X-linked Traits Assignment.pdf 100% Times New Roman 14px 1.5pt : BIUS A A X2 x2 E E Gemeuux. A LIIKCU Genes In fruit flies, eye color is a sex linked trait. Red is dominant to white. 1. What are the sexes and eye colors of flies with the following genotypes: XRX' XRXR XRY XY L 2. What are the genotypes of these flies: white eyed, male white eyed, female red eyed female (heterozygous) red eyed, male 3. Show the cross of a white eyed female X 'X'with a red-eyed male X Y 4. Show a cross between a pure red eyed female and a white eyed male. What are the genotypes of the parents: & How many are: white eyed, male white eyed, female red eyed, male red eyed, femaleOnine Sioes O Copy of LAB 12 Investigation: M X E 4.5.3 - Google Docs 1SMmahtkxDnuy9mVI0YRxYMy2hoeQW_wnAmFf365-QV8/edit#slide=id.g9fc3f6e2a3 0 39 ☆回 @ nge Tools Add-ons Help Accessibility O Slideshow Last edit was seconds ago 田 Background Layout - Theme Transition 1. t 2 3. ILI4 5 6 7 8 9. 15. Final Synthesis. Describe how a cell that is FIXED can be used to estimate the time spent in the phases of mitosis. Explain the process you used to determine the times for each phase. ker notes Explor
- pls make it comprehensivePls someone explain this to me. I literally have no idea why the answer is 73. Any explanation for me to understand greatly appreciated and i will give thumbs .up.actice-Secret Wor x Clever | Portal Picture Vocabulary from Resour x urses/23798/assignments/522627 Image result for a d.. 6 Picture ok G cenzoic era - Googl.. G the background inf. Q Test: Srta. Gálvez P. Name: Date: art I: Secret Word rections: Use the clues to complete the puzzle and find the secret word. 1. 2. 3. The comparison of the energy consumed in farming with the energy contained in the crops Substances found on Earth that are necessary or valuable to humans Sacrifices a society will make to protect resources 4. The process of designing human living environments 5. People living together by a set of laws or customs 6. Maintaining a society without consuming too many natural resources 7. A decision-making process in which the economic and ecological price is weighed against the benefit 8. Variety of life within an ecosystem 1. _ G 2. 3. E 4. N. 5. 6. 8. Clue: If all populations were to use resources responsibly, we would have- DELL
- b ueton S deo4 winged dincs anel Samuels-V x r Sing https://docs.google.com/document/d/1Rd3yEXBWtvpR3nXlyNdEYqyjdDgOts37t7tMXZFQXU/edit B Untitied dxument - G X ert Format Tools Add-ons Help Last edit was seconds ago Normal text Arial 18 IUA 加 证,而,回 X ent will 1. Larry Martin and David Burnham (U of Kansas) made their 3-D model of microraptor from a mold of a single microraptor fossil. How was the hip joint of the model configured and what does this suggest about microraptor and the origin of flight? 947 AM #メ 144 240 MO 8. 6.File guft 1.yt Machine Cochise14ee7 Lane 0 Pmer. DTarPOPD mob Comment 17703 Spacing 15.06 Siga C 17A 4 G 2 Bases 0 an 2004 Gelstat ime123 219 20 30 60 70 NNACTCA TCTOGTGGA TTC CTA TCCTG AC A AG TGATGTG CAAAC TG GTAACTC TG AG GCAGATAAC CA G GG CA AA AAGGTG TATAAG 100 110 140 100 CAGA AG TC CGGA AA A TCA TT TAA 170 TAAA ACA AAGCCCTAACT TG GAAG AAGT TCA GTTTTACACA TCT TTA TA TG GAGAGAA 180 TAT TCTAT TA ATOTCCTGT TA TATT TG TCA TATTCA TA CAGT TGTCACAGTATATT TCAAAC CA AC TG TTTAAAA ACAAAC TO AAATAAA 210 230 240 260 270 AAATTTAAATACCCT TA TG TA AA ATAG GCT TC CC TG GTG GCTCAG GG GTAAAAA ACTCGC CCGC CA ACGCAG GAGATGTAGAT TTGATC CCT 300 310 340 350 410 430 440 GG GT TAG GA AG icCCTa GAGA AGGAAATGAAAAAC CACTCTAG TAT TCT Tac CTG GG AAATC CCA TGGACAG AG GAGCOTO GAG G Gc 490 500 SI0 530 TACAGTCCATGGGAGTCGCAA A AGAGT TG GACATG ACTAA ACA ACAACATATAAAATAACCT TACTC CATAATGTCAAACT TATOTCACAC S40 AAA ATGCAA AGT TCT TACATCTAT TAACTTTTATGOT TAAATATA ACCTAATGCACTOTTT TATACAGCA ACAACTACT TT TT TATTT TAAA…SATestprep, LLC- Online State es/test/tq.php?testid-9848strandid=4936&element=D&assignment id-41828865&load test=18teacherPreview=#test A cellular protesses, maximiZing cIcIency. The ENDOSYMBIOTIC THEORY 3nascond edybee pel, he eady nukarycte ponsuned otosuhetc ngs n the plas membrane t nn ses pokaryote ge me to endonmbe comporen Incluting anuceus ns endpl um baderis roued int Endplaun cke Nudes Phot etic baceriam Modern photosynthetic ukaryote Proto-ukaryote -Meochondrim Atec bacenum Anetredon even te ancesia kaye conumed ae bic bactia fat evoived eto mnodhonca Modern heteotrophic eukanyote The diagram provided shows the evolution of membrane-bond organelles in eukaryotic cells. The Endosymbiotic Theory proposes that the organelles distinguishing eukaryote cells evolved through symbiosis of individual single-celled prokaryotes. Which of these statements provides supporting evidence for the endosymbiotic theory? A) Chloroplasts have a single phospholipid membrane. B) The DNA in…
- les/test/tq.php?testid=2804&strandid%3D&element%3D&difficulty=assessment&assignment_id%3D45196931&load_test%-D1&teacherPr B Brainly.com-For st.. O Instagram N Netflix a Escape Room (Und. USATestprep, LLC - E Google Docs Stu wrerhd.cells at rer rote due to the siiple diffsion of Save C) 01ann suan an sianua LUPInaPLiaipaih ep snan aun aAPa IM JaPAA active transport. Glucose molecules will move from the cells into the solution in the beaker D) through facilitated diffusion. When examining the major macromolecules in the cell, a student isolates two molecule types that are directly responsible for cellular energy. A comparison of which molecule types will be most likely to include the molecules primarily responsible for cellular energy? A) proteins and lipids B) carbohydrates and lipids proteins and carbohydrates D) carbohydrates and nucleic acids Proteins and polysaccharides are polymers. These polymers are formed by dehydration synthesis. Which statement correctly identifies a…/d/1SMmahtkxDnuy9mVI0YRxYMy2hoeQW_wnAmFf365-QV8/edit#slide=id.g9f123b567f 0 45 * D Saving.. range Tools Add-ons Help Accessibility Last edit was 7 minutes ago Arial в I U A > 12 + 1 2. |. 3 | 4. I 5 6 9. What is the longest phase of the cell cycle. Suggest a reason for this to be the case. Before entering mitosis, the cell expands and duplicates its DNA. 10. Are the other phases of mitosis equal (or close)? Suggest a reason for any differences in the timing of mitosis phases. 中 11. You were asked in the beginning to suggest which phase would be the most difficult. Now that you've viewed cells in mitosis, what did you find difficult about completing the table on the previous slide? eaker notesd/1SMmahtkxDnuy9mVIOYRxYMy2hoeQW_wnAmFf365-QV8/edit#slide-id.g9f123b567f 1_0 ☆回 3 Saving.. D Slideshc ange Tools Add-ons Help Accessibility Last edit was 9 minutes ago 田 Background Layout - Theme Transition |. 1 2. 3 I 4 5. 6. 8 9. . The image shows the blastula of a whitefish. A blastula is an early embryo that is growing rapidly. 12. Examine the blastula slide. How does it differ from meristem slide? 13. What phase of mitosis can you find on the slide. Use the circle tool to identify it on the image? 14. How do the number of cells in interphase compare to that of the onion? Suggest a reason for this difference. ker notes