What is the isoelectric point of this fragment? DHVTHLRKMG
Q: What physical parameters of a protein control its migration on electrophoresis?
A: Electrophoresis is a laboratory technique used to separate DNA, RNA, or protein molecules in the…
Q: Identify the nucleotide. CH HN 9. N' O. 0-P-OCH2 O DUMP O dGMP O DAMP O dCMP O dTMP
A: Given below is a structure of nucleotide as it contains a base, sugar & phosphate group. The…
Q: Does crude mRNA have density? if so what is the density value ? Thank You
A: Introduction mRNA is single stranded RNA. Which carries genetic information from DNA to ribosomes…
Q: Explain the synthesis process of Losartan? Please answer at your own words
A: The process in the synthesis of losartan are: Alkylation of methanol…
Q: What does BCR ABL stand for?
A: B-cell receptor (BCR) serve in recognition of the antigens and are present at the surface of the B…
Q: Which isomer- (R)-arginine or (S)-arginine is D-arginine? O (R)-arginine O (S)-arginine Submit…
A: Isomers are molecules with same molecular formula and different arrangement of atoms. Enantiomers…
Q: CH3CO-ETATKAELLAKYEATHK-CONH2 4. A polypeptide comprised of 17 amino acid res- idues with the…
A: Polypeptide: These are chains of amino acids with peptide bonds that connect them. Dehydration of…
Q: What is the complementary strand of TTGACAGTAAAA?
A: Deoxyribonucleic acid (DNA) consists of two polynucleotide chains which are held together by…
Q: If the sequence of mRNA is 5'-AAUCGUACGGAUGCCGAAAUACCCAUUAGGGAUUGCAUAGCGAGCAACGGAC-3', what is the…
A: Protein is the final product of a gene that determine the phenotype of the organism. Protein…
Q: Cmet-leu-phe-arg-glu-glu lou-ser-tou E)met-arg-glu-arg-glu-arg 231frecall) Agarose gel…
A: DNA, or deoxyribonucleic acid, is a molecule that holds the biological instructions that distinguish…
Q: Are all the proteins separated properly using isoelectric focusing? Why or why not?
A: The pH at which the net charge on a protein is zero is termed its isoelectric point and is…
Q: What is the tagged specific structure
A: The picture shows an opened up ribcage of a carcass. spine or vertebral column could be seen running…
Q: COMPLEMENTARY
A: COMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGC is given below
Q: What is the nucleolus?
A: The nucleolus which is the region present inside the nucleus of a cell and they plays important role…
Q: What is the beta-pleated sheet?
A: When two or more polypeptide chain segments line up side by side, beta-pleated sheets form. A…
Q: What is the net charge of the peptide at pH 7 that is synthesized from this DNA sequence? 5'…
A: As we know that the DNA sequence exhibits codons, which helps in the formation of mRNA, and then…
Q: What are the necessary conditions for the generation okazaki fragments?
A: The short sequences of DNA which are formed by at the lagging strand during replication is called…
Q: -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAGGCTATATTCACGTGGTACGCTA 3' 3'…
A:
Q: Are there other possible conformations of the double helix?
A: Introduction: DNA is a genetic material that transfers from one to another. It is a type of nucleic…
Q: What secondary structural elements are most likely present in this sequence? Please annotate the…
A: Proteins are polymers of amino acids linked by peptide/amide bonds between the carboxyl group of one…
Q: Explain how the use of radiolabeled amino acids in this procedure helped to reveal the genetic code.
A: The nucleotide sequence in the genetic material which recognizes the amino acid sequence is called…
Q: 5'-GATTACAATAGGAATTC~~ GAATTCTCGTGACTCCG-3' 3'-CTAATGTTATCCTTAAG~ CTTAAGAGCACTGAGGC-5' Which of the…
A: PCR or polymerase chain reaction is a DNA amplifying technique where a short piece of a gene or a…
Q: The oligonucleotide d-ATGCCTGACT was subjected to sequencing by Sanger’s dideoxy method, and the…
A: Electrophoresis is a technique that separates the molecules basing on the differences in the charges…
Q: Method on the following 5 sequences and find the best multiple sequence alignments. Sequence # 1:…
A: Progressive alignment is a heuristic for multiple sequence alignment that does not optimize any…
Q: How do you translate this into amino acid sequence
A: The process of synthesis of protein with the help of messenger RNA is called translation. In the…
Q: why are 2D NMR spectra symmetrical
A: 2D NMR spectra is used to determine the structure of a molecule. It is used for molecules that are…
Q: Ile-Ala-His-Thr-Tyr-Gly-Pro-Phe-Glu-Ala-Ala-Met-Cys-Lys-Trp-Glu-Ala-Gln-Pro-Asp-Gly-Met-Glu-Cys-Ala-…
A: Most common secondary are the α-helix and the β-pleated sheet. Both the secondary structure is…
Q: EboV from Guinea pig Reference DNA Sample mRNA Protein
A: The tiny living creatures such as bacteria, viruses, fungus, algae, and protozoa have a significant…
Q: Oxytocin, a hormone peptide of nine amino acids, is widely used in obstetrics to induce uterine…
A: Oxytocin(OT): It is a 9-amino acid peptide that is primarily synthesized in the neurons of the…
Q: Transcribe the following DNA nucleotide sequence and determine their respective amino acid products.…
A: Transcription Formation of RNA over DNA template is called transcription.
Q: What are the Okazaki fragments?
A: Deoxy ribonucleic acid (DNA) is the genetic material of most organisms that carry coded genetic…
Q: 1. For each of the sequences given below, list what type of secondary structural element, if any is…
A: Proteins are found in four structures namely: Primary which is a linear sequence of amino acids.…
Q: What method could be used to make an immobilised library of 6 different peptides, all differing by…
A: INTRODUCTION Peptide-based molecular probes identified by bacteriophage (phage) display technology…
Q: GTTTTCACTGGCGAGCGTCATCTTCCTACT 10. Generate a secondary structure prediction for one identified…
A:
Q: how would you identify whether or not complete resolution of the three amino acids has been achieved
A: An amino group and an acid group-containing organic molecules are called Amino acids. At the point…
Q: You were able to extract an amino acid sequence from an unknown protein you process through mass…
A: An analytical tool that is used for the purpose of measuring the ratio of mass-to-charge, is called:…
Q: What are Okazaki fragments? Why are they formed?
A: DNA replication is the process by which double-stranded DNA is copied to produce two identical…
Q: From the above sequence (DNA: ATGGATCCGCTTTAG), what is the amino acid sequence?
A: - Cells decrypt mRNAs by reading their nucleotides in teams of 3, known as codons. Here square…
Q: KIF1A has only a single motor domain. What additional structural elements would you expect to find…
A: KIF1A is kinesin like protein ,which act as the axonal transporter of synaptic vesicles or…
Q: What is the complementary sequence of the given nucleic acid sequence? (write your answer in the…
A: Introduction : The rules of base pairing (or nucleotide pairing) in DNA are: A with T: the purine…
Q: Below is a sequence of DNA.…
A: Amino acids are the building blocks of proteins. The building blocks of life are amino acids and…
Q: what are the first 4 amino acids in the polypeptide sequence of SARS-CoV-2 surface glycoprotein
A: The coronavirus disease caused by the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2)…
Q: what are the necessary conditions for the okazaki fragments
A: Nucleic acid synthesis occurs solely within the 5'->3' direction as a result of the…
Q: Are all the proteins separated properly using two-dimensional (2D) gel electrophoresis? Why or why…
A: Two dimensional gel electrophoresis is an analytical technique that uses two techniques i.e.…
Q: Sickle cell hemoglobin DNA CACGTAGACTGAGGACAC.. io.. A ... C... Sickle cell hemoglobin MRNA: Sickle…
A: Mutations are the change in the sequence of the DNA. Even a change in single base pair produces…
Q: If the sequence of mRNA is 5'-AAUCGUACGGAUGCCGAAAUACCCAUUAGGGAUUGCAUAGCGAGCAACGGAC-3' , what is the…
A: The genetic code is the set of rules used for translation of the information encoded within genetic…
Q: Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC What human disease has been connected to this gene?…
A: The given sequence CCACCTGTACCCGGACACACCCTGGTGTCC is a protein sequence that encodes the protein…
Q: What are Okazaki fragments and how they are formed?
A: As the name suggests, DNA replication is a process that creates two identical copies of the original…
What is the isoelectric point of this fragment?
DHVTHLRKMG
Step by step
Solved in 2 steps
- TAC-ATA-ACG-CGA-CAA-CTA-AAA-ACT Write the amino acid sequence of the protein that would be formed by translating this plece of DNA. You can use the three letter abbreviations for the amino acid in each box, do not use the name of the full amino acids, Use the abbrevlation of the amino adid exactly as Itswritten in the table (including the appropriate capltalizations For example it your answer for amino acid 1 is"Methionine" you would write MET in the box (not Met or met) Second Later UUU UUUC Phe UCU UAU Ser UAC UAA UAG Tyr UGU Cys U Leu UCA ucG UGC Stop uGA Beop UUG Step UGG Trp G Cuu C cuC CUA CUG CU Leu Coc CCA CG CAU Pro cGu CAC CAA CAG His CGC Arg CGA CGG 1st 3rd letter AUU A AUG AUA AUG ACU le AAU AAC AGU ACC Asn Ser U leBer ACC ACA Mct ACG The AAA AAG ACA Lys AGG Arg acu Val GCC GCA GCG GAU GAC GAA GAG GOU GGC GGA GGG Arp G GUC GUA GUG Ala Gly Glu Seovence of the protein, 1st amino acid. 2nd arnino acid: 3rd amino acid: 4th amino acid Sth amino acid: 6th amino acid: 7th amino…What are Okazaki fragments? Why are they formed?Identify the primary sequence for the polypeptide that yields these fragments upon treatment: His-met-thr-met-ala-trp; Leu-asn-asp-phe; Val-lys obtained from chymotrypsin Leu-asn-asp-phe-his-met; Ala-trp-val-lys; Thr-met obtained from CNBR
- Determine the sequence of a polypeptide treated with trypsin and chimotripsine. Below are the fragments generated with each treatment. Determine the original sequence for both fragmentations (reduerde that they must be equal in the order of amino acids) Quimotripsina 1. Leu-His-Lys-Gln-Ala-Asn-Gln-Ser-Gly-Gly-Gly-Pro-Ser 1. Gln-Gln-Ala-Gln-His-Leu-Arg-Ala-Cys-Gln-Gln-Trp 2. Arg-lle-Pro-Lys-Cys-Arg-Lys-Phe Trypsin 1. Arg 2. Ala-Cys-Gln-GIn-Trp-Leu-His-Lys 3. Cys-Arg 4. Gln-Ala-Asn-Gln-Ser-Gly-Gly-Gly- Pro-Ser 5. lle-Pro-Lys 6. Light 7. Phe-Gin-Gln-Ala-Gln-His-Leu-ArgWhat is the beta-pleated sheet?A tridecapeptide yields the following fragments when partially hydrolized. Determine the sequence of amino acids in the tridecapeptidedrolyzed. Determine the sequence of the tri decapeptide. tridecapeptide à lys-arg + gly-phe-pro + phe-ser-asp-lys + pro-phe-ser + asp-lys-arg-val + gln-ala-tyr + val-trp-gln. Determine the sequence of amino acids in the tridecapeptide
- Drew the peptide sequence and write its full name Cys-Gln-Lys-His-Ala-Ser-GlnTable I CACGT A GA CTGAGG ACTC CACGTAGACTGAG G ACAC Wild-type beta-globin gene fragment Sickle-cell beta-globin gene fragment > Circle the mutation in DNA of the sickle-cell beta-globin gene fragment Compare fragments of DNA the wild-type and mutant beta-globin genes in the Table I above, what are the similarities and differences you observe?What is the melting temp. of the following double-stranded DNA fragment TCAAAAATCGAATATTTGCTTATCTA AGTTTTTAGCTTATAAACGAATAGAT
- Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC What human disease has been connected to this gene? Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where the protein carries no net electrical charge) of the protein.Please provide a: Fischer projection of a-L-mannopyranose. and A Haworth projectionof b-D-talopyranose.Ile-Ala-His-Thr-Tyr-Gly-Pro-Phe-Glu-Ala-Ala-Met-Cys-Lys-Trp-Glu-Ala-Gln-Pro-Asp-Gly-Met-Glu-Cys-Ala-Phe-His-Arg What will be the secondary structure formed from this sequence?