What will happen to you if your brain is damange?

Q: Is the blood in motion or not in motion after an activity?

A: Our blood is carried to different organs by the arteries continuously. The heart pumps the blood (ox...

Q: The lumbar region is ________.a. inferior to the gluteal regionb. inferior to the umbilical regionc....

A: Vertebrae of a human spine is divided into cervical, thoracic, lumbar, sacral and coccygeal. Out of ...

Q: Use an example to describe tumor suppressors

A: Cancer is the state of uncontrolled cell division that has some genetic factors.

Q: Describe the bacterial colonies providing information on shape, color, size, elevation and edge appe...

A: Nutrient Agar is used for the cultivation of bacteria and for the enumeration of organisms in water,...

Q: e the list of endemic species provided below to create a phylogenetic tree showing the morphological...

A: Endemic Species are:- Phillippine Eagle Tamaraw Waldens Hornbill Phillippines Tarsier Red Vented Co...

Q: ENDEMIC SPECIES IN THE PHILIPPINES Eggs with Shells No. Vertebrae Hair Wings Bilateral Symmetry 1 Ph...

A: Phylogenetic tree is a representation in which relationship of taxon with each as well as it's ances...

Q: eries of steps rat nuch to capture in s than would be r chan would be rel

A: The less total energy is released in multiple steps than would be released in a single step. Only a ...

Q: A group of closely related strains, not all identical * a. class b. specie c. no...

A: Strains are genetic variants, subtypes or culture within a biological species. Class is the group of...

Q: The large muscle group that attaches the leg to thepelvic girdle and produces extension of the hip j...

A: Introduction: Muscular tissue is a specialised animal tissue that applies force through contraction ...

Q: What is the importance of Recombinant DNA Technology in the Molecular Laboratory

A: Recombinant DNA technology- Recombinant DNA technology is the joining of two different DNA molecules...

Q: Question 8 What causes eyeshine in some animals like cats? O a reflective layer at the back of the e...

A: 8. ANSWER;- A reflective layer at the back of the eye that allows light to bounce around more, enhan...

Q: Identify the statement below that is the MOST TRUE O All personality traits are equally heritable.

A: Personality traits are those which we acquire during our lifetime.

Q: What is label #7? (snail shell looking thing) A. Cochlea B. spiral valve C. Vestibule D. Eustachian ...

A: Ear is one od the sense organ that help us in hearing. There are majorly divided into 3 parts,  *out...

Q: As energy passes from blue-absorbing chlorophylls down to red-absorbing chlorophylls, surprisingly, ...

A: The process of photosynthesis involves the absorption of sunlight by photosynthetic pigments. There ...

Q: Give the functions of the following bacterial structures. Granules Pili Flagella Endospores Capsule

A: Bacteria is a prokaryotic cell which has many organelles to facilitate different functions.

Q: You counted 40 colonies on a plate in your dilution series. The plate was inoculated with 1.0ml from...

A: A microbial sample will have enormous amount of cells. To estimate this by calculation, the sample i...

Q: [Question 27] Helping kin raise offspring is one way individuals can increase their inclusive fitnes...

A: Introduction: Pedigree analysis is the study of a particular trait that is inherited from one genera...

Q: 23. On the basis of shape, identify the type of microbes.

A: *In bacteria, the cell wall is a rigid structure with thickness around the cell and it is responsibl...

Q: Red-green color blindness is inherited as a sex-linked recessive trait. The gene is found on the X c...

A: The answer is he can't(unless there is a mutation )

Q: QUESTION 2 Cotransporters... UA Do NOT hydrolyze ATP UB: Include symporters that move ions in the sa...

A: Co-transporters are the membrane carrier proteins comes under secondary active transport of substanc...

Q: What are the major components of an osteon?

A: Introduction :- Bones makes up the important part and structure of our body . Their anatomical struc...

Q: The inner mitochondrial membrane exhibits all of the fundamental characteristics of a typical cell m...

A: Some unique characteristics of a typical cell membrane include: Presence of cristae. Restricted amo...

Q: What are the 4 mode types of disease? Explain each

A: Health is defined as the state of physical, mental and social well being. Disease refers to a condit...

Q: The Calvin cycle reactions that fix CO2 do not function in the dark. What are the likely reasons for...

A: The carbon cycle can be described as the series of reactions associated with fixing carbon dioxide (...

Q: Differentiate vasculogenesis from angiogenesis. Explain why blood vessels degenerate as well as the ...

A: Vasculogenesis is the process of blood vessel formation from endothelial progenitor cells. Angiogene...

Q: on dioxide in C3 plants in preparation for the Calvin cycle. Explain the chemical pathway used to fi...

A: The process by which plants use sunlight, water, and carbon dioxide to create oxygen and energy in t...

Q: Which of the following are jawless? Choose all that apply. O hagfish O lampreys O bony fishes O cart...

A: Jawless organisms are belongs usually to class Agnatha and primitive in nature. 

Q: Does changing the sequence of nucleotides always result in a different amino acid sequence? Explain

A: No, changing the sequence of nucleotides does not always result in a different amino acid sequence.

Q: intermediate filaments 1. In eukaryotic flagella, the fibers that slide past one another due to the ...

A: Intermediate filaments: They anchors the nucleus and maintains its rigidity Microtubules: They aids ...

Q: similarities and differences between malaria and covid 19

A: An infection is the invasion of an organism's body tissues by disease-causing agents, their multipli...

Q: the

A: DNA acts as the genetic material in most of the organisms . DNA stands for the deoxyribonucleic acid...

Q: Edmontosaur or hardosaurs what ways can they defend itself from predators like large with powerful j...

A: INTRODUCTION Endmontosaurs They are large dinosaurs lived in North America during late Cretaceous pe...

Q: DNA pol 3's inability to begin the replication process is solved by which enzyme? helicase primase D...

A: DNA is genetic material in most of organisms . It act as template for synthesis of its own . This pr...

Q: Ronald was the victim of an assault and has symptoms of posttraumatic stress disorder as well as dep...

A: The diagnosis of the disease is very important in medical science. It helps in proper treatment and ...

Q: How is the concept of norm of reaction related to the lack of yellow hydrangea flowers illustrated i...

A: Hydrangea also know as hortonsia it is a genus of over 75 species of flowering plants in native to A...

Q: (a) Gryllus pennsylvanicus prefers sandy soil. (b) Gryllus firmus prefers loamy soil. Based on the i...

A: Geographic, behavioural, physiologic, or genomic obstacles or differences that prevent a species fro...

Q: Why does Genus entamoeba called true amoeba?

A: Introduction Entamoeba:- It is a tiny protozoan parasite of man and animals, Entamoeba is a genus of...

Q: If the pressure in the ventricles is higher than the pressure in the atria, but lower than the press...

A: Heart valves open and close in response to pressure changes inside the heart chambers. the fluid und...

Q: Distinguish sister chromatids from homologous chromosomes.

A: Homologous Chromosomes Diploid cells have two sets of chromosomes, which are referred to as homolog...

Q: VilI be easy for you to answer. Activity 5: Solving Problem Directions: Solve the given problem belo...

A: Introduction :- There are different types of inheritance patterns for any gene , these are - autosom...

Q: Identify two body processes that occur by mitosis

A: Mitosis is a cell division that forms two daughter cells from a single parent cell.  

Q: are my answers correct?? there were blank spaces

A: The DNA consists of 4 nitrogen bases which are Adenine (A), Thymine (T), Guanine (G), and Cytosine (...

Q: An important function of the inner mitochondrial membrane is to provide a selectively permeable barr...

A: Introduction Mitochondria are eukaryote cell organelles or components. They're not in the nucleus; t...

Q: According to the director of addiction services at the U of IL Hospital and Health Sciences System, ...

A: Option B.  

Q: A can cleave the hinge of each heavy chain as shown below.

A:  IgG is cleaved with a protease that is the one which targets the hinge region. Proteolytic cleavage...

Q: What is microbial community?

A: Answer :- Microbial community group are gatherings of microorganisms that share a typical living spa...

Q: Where is the sucrose produced by photosynthesis generated?

A: Photosynthesis includes light-dependent and light-independent phases.  

Q: Much of our understanding of ATP synthase is derived from research on aerobic bacteria. What makes t...

A: ATP synthase is a mitochondrial enzyme that catalyzes the conversion of ADP and inorganic phosphate ...

Q: Our DNA sequence: 5' - CGCTTATAATCGTTACGACGGCAATTA CGGGATTCCTCGCGAAA - 3'. What is the RNA transcrip...

A: The nucleic acids are DNA and RNA. Nucleotides, which have a five-carbon sugar backbone, a phosphate...

Q: The eukaryotic cell at left is in the processof cytoplasmic division. Is this cell from aplant or an...

A: Cytoplasmic division is otherwise called as  Cytokinesis which separates the original cell, its orga...

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.