Q: Suppose you are analyzing a nucleic acid sequence which contains guanine, cytosine, adenines, and…
A: DNA: DNA is a polymer made up of two polynucleotide chains that coil around one another to form a…
Q: Stochastic events change both the gene pool and gene frequencies over time. True False
A: A population's genetic makeup evolves throughout time as a result of evolution. In nature, chance…
Q: 4. Compare the overall body structure of the cave fish and the minnow below. MILL cave fish minrow…
A: Cave fishes These fishes are called so because they have adapted themselves to live in caves and…
Q: 4. In humans, pointed eyebrows are dominant over smooth eyebrows. Angela’s father has pointed…
A: The pointed eye brow is dominant over smooth eye brow. Let P allele encodes pointed eye brow. It is…
Q: What do you think helped Homo sapiens thrive and populate the world? explain
A: Homo sapiens is the scientific name for the modern human species, which is the only surviving member…
Q: Identify the structure indicated by the letter B. A B C 19
A: The heart is a vital organ responsible for the circulation of blood throughout the body. It has four…
Q: From NTSA case study https://static.nsta.org/case_study_docs/case_studies/cystic_fibrosis.pdf…
A: For cystic fibrosis (CF), a condition that has been the subject of extensive research but for which…
Q: The Hardy-Weinberg Equation 2. Sickle-cell disease (SCD) is a blood disorder. It causes an…
A: The Hardy-Weinberg equilibrium says that the allele and genotype frequencies will remain same…
Q: a polysaccharide that is formed in plants to store glucose is a. starch b. glycogen c. lipid…
A: Introduction :- Polysaccharides are complex carbohydrates made up of many sugar units, or…
Q: During what phase of CHO digestion do the products of starch hydrolysis break down further to a…
A: During 3rd step of CHO digestion i.e. in small intestine with the help of oligsaccharidase enzyme,…
Q: The patient phenotypes as group AB, D-positive. Her antibody screen is negative on the sample drawn…
A: Introduction :- Blood is a vital bodily fluid that circulates throughout the body, delivering…
Q: In order to be activated, the [Select] to bind to [Select] [ Select ] [ Select ] [Select] N…
A: Introduction Cell signaling, also known as signal transduction, is the process by which cells…
Q: Question 24. The temperature of stringent washing (Tw) is calculated using the Tm (melting…
A: Stringency is used to define the degree of similarity between the probe and the nucleic acid bound…
Q: Which is the simplest monosaccharide? How is it synthesized in plants?
A: Introduction :- Plants are multicellular organisms that belong to the kingdom Plantae. They are…
Q: 2. In a typical eucaryotic cell, the pH is usually around 7.4. What is the [H+] in a typical…
A: Introduction: Large and complex organisms are made up of eukaryotic cells, which have a nucleus…
Q: 6. Below are some vestigial structures found in humans. For each, hypothesize what its function may…
A: Note:- please always mention the needed parts in case of multiple questions. Thank you! Vestigial…
Q: Which pairing is CORRECT? Select all that apply Group of answer choices Structural carbohydrate -…
A: Carbohydrates, also known as saccharides, are a class of organic compounds that consist of carbon,…
Q: As inspired air moves through the conducting airways, the temperature of the gas becomes that of the…
A: Inspired air contains nitrogen, oxygen and carbon dioxide as the main components. As this air moves…
Q: 3. Below is the result of a DNA (Sanger) sequencing reaction using the primer indicated on the…
A: Sanger sequencing allows for the accurate and reliable determination of DNA sequence information by…
Q: Colorblindness is a sex-linked traits in humans. If a normal-visioned mother and a colorblind father…
A: One of the main risks associated with colorblindness is the potential for accidents or mishaps due…
Q: How did the classification of a microorganism change from kingdoms to domains of life? * How do cell…
A: This question includes the several topics related to the classification and evolution of…
Q: For a cell line with a mutated Ras protein that is always inactive, which of the following…
A: RAS protein is a family of small GTPases that play a crucial role in signal transduction pathways…
Q: A drug P gives a metabolite M1. What are the possible structures of P and M1 if a delta mass between…
A:
Q: 2a. First, use your calculator to calculate the log of the molecular weight for each ladder band.…
A: Ladder Band: A DNA ladder is a standard sample of DNA fragments of known sizes that is used as a…
Q: Explain the outline below: Subviral agents: Viroids “viroid” for species “viroid” for genera…
A: The outline alludes to the viroids, which are subviral agents classified according to taxonomy.…
Q: Explain Avery-MacLeod-McCarty experiment (the 1940's) with capsule forming bacteria (smooth) and…
A: Bacteria are single-celled microorganisms found in all environments on Earth, including soil, water,…
Q: Monohybrid crosses 1. The following lists represent genotypes at imaginary genetic loci. In each…
A: Introduction :- Homozygous recessive refers to a genetic condition in which an individual has…
Q: 8.Using Punnett squares, phenotypes, and genotypes, show me the difference between incomplete…
A: A Punnett square is a diagram that is used to predict the outcome of a genetic cross between two…
Q: 1. Write down the method of slide mount preparation of the leaf surface:
A: The microscope is an instrument that allows observing the "microscopic" structure of the cells and…
Q: Does a reef consist mainly of living or non-living coral? Explain
A: Coral is a marine invertebrate that belongs to the class Anthozoa of the phylum Cnidaria. Corals are…
Q: QUESTION 36 Cardiac output equals: O stroke volume squared O stroke volume cubed O heart rate +…
A: Heart also plays a key role in regulating blood pressure, which is essential for maintaining proper…
Q: In your paper, respond to the article, Kenya- The Green Belt Movement, by considering the importance…
A: We must throw attention on Kenya's Green Belt Movement by emphasizing the value of this real-world…
Q: Trichomonas vaginalis is a Protozoa transmitted via sexual intercourse by what type of infective…
A: Microbiology: The science of tiny creatures' biology includes viruses, bacteria, algal, fungus,…
Q: Dihybrid crosses and gene interactions 9. As we have already seen, in lemmings, hair colour is…
A: Genetics helps us understand the underlying causes of diseases and disorders. We can learn more…
Q: Which meiotic division(s) reduce(s) chromosome number (i.e., meiosis I, meiosis II, or both)?…
A: Introduction: Meiosis is a eukaryotic cell division methodology. Each of these phases happens in two…
Q: Provide a illustation/diagram
A: Anaemia: In human beings, the oxygen in the blood is carried with the help of red blood cells. This…
Q: Dietary restrictions for clients on monoamine oxidase inhibitor (MAOI)
A: Introduction Monoamine oxidase inhibitors (MAOIs) are a type of antidepressant medication that work…
Q: Which is the simplest monosaccharide? How is it synthesized in plants
A: Polyhydroxyaldehydes or ketones with an unbranched "C" chain are called monosaccharides. *The most…
Q: List of Common Blood Additives (Anticoagulants)
A: Anticoagulants are substances or drugs that prevent the formation of blood clots in the circulatory…
Q: GMOs are highly controversial. Are GMOs dangerous? Should GMOs be labeled as such? Why, or why not?…
A: The debate over GMOs is highly controversial. GMOs, or genetically modified organisms, are organisms…
Q: Which of the following is not a type of RNA? mRNA pRNA tRNA rRNA
A: The term "RNA" stands for ribonucleic acid, which is a complex substance with a high molecular…
Q: Explain in detail why Microsytic anemia is caused by Iron deficency. Give reasons alongside…
A: Microcytic anemia is caused by iron deficiency because the body requires iron to produce hemoglobin,…
Q: Resistance to antibiotics 11. Once resistance occurs, what has the scientific community had to do?…
A: Note:- please always mention the needed points in case of multiple questions. Thank you! Bacteria…
Q: How have GWAS's changed the field of genomics and what do they allow that other methods do not? What…
A: Introduction :- Genomics is a field of biology that focuses on the study of the structure, function,…
Q: Lake turnover in temperate locations results in: Group of answer choices A. freezing of water from…
A: Introduction Lake turnover, also known as lake mixing, is a natural process that occurs in…
Q: Muscular dystrophy is a group of disorders that involve muscle m weakness and loss of muscle tissue…
A: Introduction :-. Muscular dystrophy (MD) is a group of genetic disorders characterized by…
Q: Which of the following occurs in the legs of goose (bird) standing on a frozen pond? Group of answer…
A: Introduction A goose is a type of waterfowl that belongs to the family Anatidae, which also…
Q: Describe the importance of how chemical structures identify lipids?
A: Introduction Lipids are a diverse group of biomolecules that are characterized by their hydrophobic…
Q: 5. Frederick Griffith observed that an unknown but heritable substance could move from a dead…
A: DNA is the genetic material that is composed of two antiparallel polynucleotide strands. Oswald…
Q: For the cat, whale, and bat, indicate what type of movement each limb is responsible for.
A: Introduction : Homologous structures : These are the structures which have similar basic structure…
Step by step
Solved in 2 steps
- What is the shape of these cells? Spirochete Spiral Cocci BacilliIf a scientist were trying to separate Klebsiella, Proteus, Shigella, and Vibrio into two separate categories, with two genera in each category, what is a characteristic they could use? Morphology Gram-reaction Oxygen requirement Motility ArrangementYou grow this weird looking organism in lab and have no idea what it is. You decide to sequence its genome and one of the reads you get back is shown below: >UnknownSequence1 GCGGTATTTGACGCCGCATTCGAAGTGGTCGATCCATTCGGCGTATCAGGACAATTTGCATATGTTGACGTTGTCGCGGGGTGGGCCCTCGATCTGGATGTCGGAGCGGGACGCGGC GAAGATCGGTGTGGCCGATAATGATTGGATCGAGGCGGTCAATCGTAACGGGGTGGTGGTGGCGCGGGCGATCGTGT
- Giardia intestinalis (old species designation was lamblia)- flagellated protozoa in a fecal smear. Must look for the trophozoites (metabolizing stage that look a bit like little faces- label them as such as well as flagella. They have 2 nuclei which are what appear as "eyes"). (1000x). Include some background material in drawing since it is not a pure cultureWhich are correct and which are not correct? 1. Amebae move by the means of pseudopodia, example Entamoeba histolytica 2. Ciliates like Blantidium coli move by numerous hairlike structures 3. Sporozoa, Plasmodium spp. have no visible means of movement 4. Flagellates like Giardia lamblia move with a whip like structure All are matched correctlyexpress some basic evolutionary relationships among groups of microorganisms i need other answers please explain well do not copy from others or i will downvote
- Which of these is NOT a group that we typically use to subdivide the medically important gram-positive bacilli? O Non-endospore-formers Irregular shaped and staining properties motile / nonmotile Endospore-formersKarelina Bologicel Supply Company Give the DOMAIN for these organismsWhat characteristics of Trypanosoma is similar to Euglena? plz include citation plz plz plz plz
- OalgaeBASE dpalgaeBAsE B galgaeBASE Figure 3. A. Oscillatoria and B. Anabaena under microscope Reference source: https://www.algaebase.org/search/pictures/ 1. What is the colony morphology of these two cyanobacterial species having?What technique separated Chlamydomonas cell bodies from flagella? gel electrophoresis ion exchange chromatography centrifugation electron microscopyPls can you identify this organism The first picture is gram stain negative The second pictures is endospore stain