Which of the following is NOT a function of the placenta? Question 23 options: To supply the embryo or fetus with milk. To transfer gases to an embryo or fetus. To transfer nutrients to an embryo or fetus. To remove waste from the embryo or fetus.

Which of the following is NOT a function of the placenta? Question 23 options: To supply the embryo or fetus with milk. To transfer gases to an embryo or fetus. To transfer nutrients to an embryo or fetus. To remove waste from the embryo or fetus.

Human Biology (MindTap Course List)

11th Edition

ISBN:9781305112100

Author:Cecie Starr, Beverly McMillan

Publisher:Cecie Starr, Beverly McMillan

Chapter17: Development And Aging

Section: Chapter Questions

Problem 9SQ

See similar textbooks

Related questions

Q: From a presumed testcross of 2 plants of genotype Aa x aa (in which A represents red and a…

A: A test cross is a breeding genetic experiment that is utilized to determine the alleles present in…

Q: Dominant ecessive I R 5 r 12 R? R 1 R 13 (V 6 R 2 14 R? R 15 rr R3 To 6000 8 10 R RR 16 R? 17 (r 70…

A: In order to label a Pedigree one should know the mode of inheritance. Most commonly there are four…

Q: refers to the relative number of offspring produced per individua Fecundity Morbidity Life…

A: "Fecundity" is a term used in ecology and evolutionary biology to refer to the potential…

Q: People with unhealthy weight issues should fast to unlock a healthy body. How does fasting affect…

A: Fasting can have both positive and negative effects on individuals, including those with unhealthy…

Q: Complete the data chart of pH values for the created yogurt. Make sure you take observations for the…

A: Yogurt is a dairy product produced through the fermentation of milk by bacterial cultures, typically…

Q: What is the allelic frequency of A for the following population: Genotype No. individuals AA 450 Aa…

A: Allele frequency is also known as gene frequency.It is the number of individual alleles of a…

Q: put the following in the correct order of the most directly visual processing pathway from eyes to…

A: The eyes are important sensory organs for vision in animals. The visual system consists of eyes and…

Q: 1. in a TATAT sequence, would the number of sequences similar to a promoter increase or decrease if…

A: In this question, we discuss the possibility of variation affecting the number of sequences similar…

Q: This clinical trial has a the smallest number of participants. Phase IV O Phase I Phase III O Phase…

A: A clinical trial is a research study conducted with human participants to evaluate the safety,…

Q: Complete the following by giving one ORIGINAL example (one of your own) in 2-3 complete sentences…

A: Tardive Dyskinesia is a neurological condition characterized by involuntary, repetitive movements…

Q: In 1956, two Corsican mouflon sheep were introduced to Haute Island, which has an area of 7.00 km^2.…

A: We must figure out the population densities for each island in order to compare the Haute Island…

Q: Describe your results in the following data chart as directed in the instructions for the laboratory…

A: TreatmentGrowthControl+++0.01% bleach-0.1% bleach-1.0% bleach-2.5% Lysol-5% Lysol-10% Lysol-0.03%…

Q: For each of the following, identify whether it will primarily cause changes in allele frequency,…

A: Gene frequency, also known as allele frequency, is the proportion of the population's total number…

Q: How can turbidity relate to the concentration of microbes present in a sample?

A: Turbidity is a measure of how cloudy or clear a liquid is. It is caused by the presence of suspended…

Q: Where are the RNA components of a eukaryotic cell synthesized?

A: A eukaryote is an organism that belongs to the domain Eukarya, one of the three domains of life,…

Q: What differentiates the temporal aspects of the human visual system from its optical properties

A: Research on the temporal elements of visual processing hasn't gotten much attention. In basic tasks…

Q: what is a website about current botanical research with a summary of the main results, and why basic…

A: The study of a plant's interior organization and framework is referred to as plant anatomy. It…

Q: Parts A-C in the table show the genotypes for two partial diploid strains of the lac operon. Gene…

A: A group of genes called the lac operon are involved in the bacterial metabolism of lactose. *Three…

Q: Which of the following is incorrect about the ATP synthase mechanism? a. It explains how ATP is…

A: ATP or Adenosine Triphosphate acts as the chemical energy carrier molecule. It is produced by the…

Q: SNAT2 (a membrane protein) determines the cell’s content of most amino acids. It acts as a symport…

A: SNAT2 is a membrane protein that plays a crucial role in determining the cell's content of most…

Q: Give only typing answer with explanation and conclusion A mothers father who is not bald marries a…

A: The likelihood of inheriting certain traits, such as baldness, can be a subject of curiosity when…

Q: what happens when two brown-eyed heterozygotes reproduce together? Build a Punnett square for a…

A: Homozygous is the condition when both the alleles of the genotype are similar like TT or tt. It can…

Q: Select all that apply: What is(are) the major target(s) of peroxides? O Cell wall O Cell membrane

A: Peroxides, such as hydrogen peroxide (H2O2), are reactive oxygen species (ROS) that can have…

Q: 1. What fermentation tube is the control tube in this experiment? 2. What two fermentation tubes can…

A: Yeast fermentation is a metabolic process that occurs in yeast cells, wherein they convert sugars…

Q: How many molecules of THF are generated per second if you found your DHFR protein to consume 6…

A: In many reactions NADPH provides the reducing power. One such reduction reaction is catalyzed by…

Q: Most fat-soluble nutrients are absorbed in the A. lymphatic system B. vascular system C.…

A: Fat-soluble nutrients are a group of essential nutrients that dissolve in fat and other lipids. They…

Q: You want to replicate Francesco Redi’s “rotting meat” experiment in disproving spontaneous…

A: You may modify and keep track of two experimental variables using the provided items to enhance…

Q: Give typing answer with explanation and conclusion Electron transport and oxidative phosphorylation…

A: Electrochemical cells play a vital role in various scientific, industrial, and everyday…

Q: Which of the following is not a factor that increases mutations? a. Fast rates of replication b.…

A: Mutation is any change in DNA sequence that can be produced by various mechanisms and may or may not…

Q: As the vertebrate lineage evolved to fill different niches, the region of the brain that received…

A: The passage depicts how the advancement of the vertebrate brain was affected by the need to prepare…

Q: How is this cell different from a typical plant cell? D VOCAL

A: Cell is the basic structural and functional unit of cellular organisms. All the cells are divided…

Q: II. Use the eukaryotic gene DNA sequence below to answer the following questions: 1 11 21 31…

A: Codons are sequences of the three nucleotides (adenine, cytosine, guanine, and uracil) which are…

Q: A cross is made between AaBbCc and aabbcc plants, and the offspring occur in the following numbers:…

A: The above question is related to dihybrid cross which is a hybrid of two organisms that have two…

Q: If the blue pigment traveled 1.5 cm, what is its Rf value? Round your answer to 2 decimal places.…

A: To calculate the Rf value (retention factor), you need to divide the distance traveled by the blue…

Q: A small section of bacterial DNA template (anti-sense) strand has the following nucleotide sequence:…

A: DNA or deoxyribonucleic acid serves as hereditary material for almost all biological organisms. It…

Q: Complete the sentences You cross two mice with wildtype (long) tails and collect a male offspring…

A: Imprinted gene is whom gene is silenced and gene from other parent us expressed. In this case from…

Q: In some types of colon cancer, stem cells have a mutation in the APC gene. What happens if the APC…

A: Colorectal cancer is a common type of cancer that affects the colon or rectum. It is also known as…

Q: If a codon found in the mRNA sequence Tessa CGA, the tRNA anticodon that would bind to that codon…

A: In protein synthesis, the mRNA sequence is read in codons, or sets of three bases. These mRNA codons…

Q: There is a early part of the finds of the first bipedal hominid to the Ardispithecines and the…

A: The evolutionary process that produced modern humans is represented by the human lineage, commonly…

Q: DNA sequence A: 5' - 3' TAACTTAAGGCCAATCGAAATCTTAAGGCGGTATACGCGTTAACCTTAAGG 3' DNA sequence B: 5'…

A: Restriction enzymes are restriction endonucleases that have specific restriction sites and…

Q: LO85 Identify whether a neuronal network is excited or inhibited based on the individual action of…

A: By considering the special highlights of neurons that make them either energized or calm, and how…

Q: The protein NK2 is a transcriptional regulator that functions both as a repressor and activator. To…

A: A regulatory protein regulates the expression of a gene by binding with that gene through its DNA…

Q: What is meant by “extreme pain, respiratory arrest (breathing stops), severe muscular contractions,…

A: Electric current levels ranging from 50 to 150 milliamperes (mA) represent the magnitude of the…

Q: (i) A repressor binds to RPA and an activator binds to RPC 1. [Select] 2. [Select] 3. [Select]

A: Gene expression, the process by which information from a gene is used to synthesize a functional…

Q: 5. Read the article on the following pages and answer the questions below. Be sure to review the…

A: Vaccination plays a crucial role in preventing the spread of infectious diseases and protecting…

Q: A gymnast is able to maintain a steady posture while on a balance beam. In order to maintain…

A: The ability of a gymnast to maintain a steady posture on a balance beam is a fine example of the…

Q: 5. Anabolic steroid use can provide athletes with benefits during training and performance. Provide…

A: Anabolic steroids are also called anabolic-androgenic steroids. these category of drugs derivatives…

Q: Ex. 33 = Microbial Hydrogen Sulfide (H2S) Production from Thiosulfate and Sulfur-Containing Amino…

A: Answer 1) sulfate is used as an electron acceptor in the bacterial metabolism which is used for…

Q: Figure 8.2: Male vs Female fruit flies The flies in the image below are your ACTUAL data for the…

A: The sex of the drosophila can be determined by their size, because, female drosophila are larger in…

Q: Insulin is a blank a soluble hormone. Therefore it can/cannot cross the plasma membrane

A: Insulin is a hormone produced by the pancreas in response to elevated blood glucose levels. It plays…

Question

Which of the following is NOT a function of the placenta?

Question 23 options:

	To supply the embryo or fetus with milk.
	To transfer gases to an embryo or fetus.
	To transfer nutrients to an embryo or fetus.
	To remove waste from the embryo or fetus.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1: introduction

VIEW

Step 2: explanation

VIEW

Solution

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Which of the following statements about the female reproductive tract is CORRECT? Question 49 options: Ovaries produce ova (eggs) and secrete hormones (estrogen) Ovaries are supported by both the mesovarium and the suspensory ligament Normal fertilization of a mature ovum typically occurs within the uterine tube The cervix is a muscular sphincter located between the uterus and vagina ALL of the above are correct
Which of the following statements are true about the cervix? Select all that apply. O It remains open to allow free passage of sperm and menses. It creates a solid plug during pregnancy for protection. It secretes mucus. It is a tube comprised completely of squamous cells. It is the area where the embryo will implant.
Which of the following is TRUE about the 'descent' of the testes and ovaries? Question 41 options: Testes and ovaries begin their descent from a retroperitoneal location, near the kidneys When compared to males, inguinal hernias in females are quite rare The descent of the testes and ovaries is completed at or before birth All of the above are true
please answer all parts if possible. A question from histology and embryology. Please answer as soon as possible.
A pregnant woman visits the doctor. The GP decides to request ultrasound imaging to check on the pregnancy. Describe why ultrasound is the imaging technique of choice to monitor foetal development in the womb. Describe how ultrasound can be used to provide diagnostic images in medicine. Highlight the role of sound for imaging and describe how sound is generated and received. Explain in detail which physical properties of human tissue is exploited by this technique. Describe the ultrasound technique that can be used to monitor blood flow and diagnose diseases that impact blood flow. Explain the physical principles underlying magnetic resonance imaging and provide three examples where it could be used to provided information not accessible with ultrasound. [9]
Which of the following is not true concerning the uterus? Group of answer choices It produces estrogen. It sloughs compact and spongy layers of lining tissue. It is the site for embryo implantation. Uterine muscle contraction expels the infant.
please answer all parts if possible. A question from histology and embryology.
Sarah experiences regular contractions during her 29th week of gestation. Which of the following is true of this situation? Multiple Choice Sarah should discontinue cigarette smoking. Sarah should be given Methergine to stop her uterine contractions. Sarah should be given terbutaline because it decreases the heart rates of the mother and the fetus. Sarah should be kept away from tocolytic drugs.
What is the source of different cytoplasmic determinants present in the embryo after fertilization? They are introduced into the cell when the zygote divides They were produced during the process of fertilization. They are within the cytoplasm of the egg cell. They are from the sperm cell.
Why it is immoral to make headless babies for organ transplants?
Some Stages of Embryonic Development Gastrulation Zygote Implantation Blastocyst The order in which the physiological stages occur during embryonic development is Answer, Answer, Answer, and Answer.
Match the stage of childbirth with its description. Question 2 options: 123 The placenta and associated fetal membranes are expelled. 123 First stage of childbirth; involves the increase in cervical diameter 123 mother bears down with contractions;this stage ends with birth 1. Expulsion 2. Afterbirth 3. Dilation