Which of the following reactions does not occur mammals? O pyruvate + NADH-lactate + NAD+ O ribulose-5-phosphoate-ribose-5-phosphate O mannose + ATP-mannose-6-phosphate + ADP + P₁ O 6-phophogluconate + NADP+ribulose-5-phosphate + NADPH + CO₂ O pyruvate + NADH+H*CO₂+ ethanol + NAD*

Which of the following reactions does not occur mammals? O pyruvate + NADH-lactate + NAD+ O ribulose-5-phosphoate-ribose-5-phosphate O mannose + ATP-mannose-6-phosphate + ADP + P₁ O 6-phophogluconate + NADP+ribulose-5-phosphate + NADPH + CO₂ O pyruvate + NADH+HCO₂+ ethanol + NAD

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Related questions

Q: Consider the following pairs of fatty acids and underline the fatty acid in each pair that will have…

A: Fatty acids are very important class of macromolecules in our body. They are the simplest type of…

Q: Metabolism is best defined as a collection of Ocellular processes that activate cell division.…

A: Biochemistry is an attempt at explaining the living cell in chemical terms. A living cell is the…

Q: QUESTION: Which of the following statements about Carbohydrates is TRUE? O The human body can…

A: Carbohydrates are one of the important biomolecules. These are also termed as hydrates of carbon.…

Q: Which of the following results are most likely to be observed in liver enzymes following initiation…

A: When subjected to a prolonged period of starvation, the level of glucose in the blood falls. This…

Q: How can you decrease (or stop) the rate of binding for a noncompetitive inhibitor? Could you change…

A: Non-competitive inhibitors are reversible inhibitors that binds to a site on the enzyme other than…

Q: Identify the type of base and sugar group present in each nucleotide or nucleoside. HO. H₂C -CH₂ ОН…

A: A nucleotide consists of a base, a molecule of sugar and one of phosphoric acid. The sugar can be…

Q: Which of the following is arranged from least to most in terms of number of sugar units ?…

A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…

Q: Substrate phosphorylation in the tricarboxylic acid. (TCA)

A: Cellular respiration is the process how biochemical energy is generated from food. It involves the…

Q: How many NET molecules of ATP are produced during the Embden-Meyerhof pathway of glycolysis for…

A: Cellular respiration is the process how biochemical energy is generated from food. It involves the…

Q: What would be the effect of a visualizing agent on the retention factor. Rf? A.Higher Rf B.Lower RF…

A: Visualising agent: The chemical agents that can be used to detect the number and location of the…

Q: Select the chemical consequences that could contribute to DNA instability at AP sites. fewer…

A: An apurinic/apyrimidinic site or abasic site can be created as a result of DNA damage or as a part…

Q: Explain how an enzyme could distinguish between the (now circled) equivalent positions in the above…

A: Aconitase is an enzyme that catalyses the conversion of Citrate to isocitrate. Aconitase is an iron…

Q: could the answer be no cooperativity as well?

A: Cooperative binding is a phenomenon where the binding of one molecule increases the affinity of the…

Q: 1. What role do eicosanoids play in the body? What is the primary fatty acid in their composition?…

A: INTRODUCTION : Eicosanoids - They are classified as a group of molecules which are being derived…

Q: Which reaction below in the glycolytic pathway has a highly unfavorable delta Gº¹ but a favorable…

A: Free energy changes: The Gibbs free energy is used to calculate the maximum amount of work that a…

Q: 5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above…

A: The DNA contain genes (functional unit) that encode protein molecules. Proteins are the "workhorses"…

Q: In an enzyme mechanism that generates a negative charge in the transition state, which of the…

A: When a substrate(S) binds to the active site of an enzyme(E), it leads to the formation of an ES…

Q: Calculate protein concentration in unknown samples 1, 2, 3: Absorbance of Unknown 1 = 0.541…

A: Given that the standard BSA concentration is 1mg/mL. 10, 20, 30 ,40 and 50 µL of the standard BSA…

Q: Answer the Questions below: 1. Based on the experiment above, what is the means of detecting the…

A: Lipids are hydrophobic compounds that are usually made up of an alcohol backbone and a long chain…

Q: purified protein sample was used in a reaction, resulting in an activity of 696.7 nmol min-1. The…

A: The activity of protein sample refers to the quantity of active protein present in the purified…

Q: true/false: Humans produce isoleucine using pyruvate as a starting material.

A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…

Q: Which of these are artificial sweeteners (Arts) and which are metabolized (Mtbs) by glycolysis?…

A: Artificial sweeteners are synthetic substitutes for sugars. These are sweet in taste and have less…

Q: Structure, localization and biological significance of glycogen.

A: Introduction Cell needs energy for various metabolic processes. Glucose breaks into pyruvate and…

Q: What mass in grams of dextrose and sodium chloride are required to prepare 250 mL of D10 NS…

A: Introduction: The term molar mass is defined as the mass of one mole of a substance. It is…

Q: 1. What mRNA sequence does the following DNA template sequence produce? DNA…

A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…

Q: A new protein is discovered that contains a pleckstrin homology domain. Which of the following…

A: Pleckstrin homology domain is a domain in protein and is made up of nearly 120 amino acids. It is…

Q: 2. Another bodily process is the urea cycle. However, a carbamoyl phosphate is necessary to begin…

A: Carbamoyl phosphate is synthesized with the help of enzyme carbamoyl phosphate synthetase requiring…

Q: Calculate and draw the isoelectric point of the tetrapeptide Ser-Leu-Phe-Pro at pH 7.0. hand written…

A: Isoelectric point is the pH at which the positive and negative charges are equal, i.e., the net…

Q: Consider the structure of TAMIS below and answer the questions that follow. ОН НО Н H ОН Н H ан .H.…

A: The given structure is a carbohydrate molecule having monosaccharide units joined via glycosidic…

Q: What elements do lipids contain?

A: Since you have posted multiple questions, we will provide the solution only to the first question as…

Q: What could be seen in the organic acid precipitation during the protein denaturation experiment if…

A: Proteins are large molecules made up of amino acid residues linked via a peptide bond. Amino Acids…

Q: 1) A ligand-binding protein showing negative homotropic cooperativity? a) should give an nH value…

A: Cooperativity or cooperative binding occurs when binding of one molecule influences the affinity of…

Q: 1. Draw (or insert) the general formula of an amino acid and label the four components. Which one…

A: DISCLAIMER FOR MULTIPLE Since you have asked multiple question, we will solve the first question for…

Q: The pentose phosphate pathway occurs in the mitochondrion of tissues actively engaged in synthesis…

A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons. The…

Q: The active site of an enzyme that uses a general acid-base catalytic mechanism contains a Glu and an…

A: In simple terms, pH indicates whether a substance is acid or base. pKa determine how strong is an…

Q: The inhibitor X prevents coenzyme Q (Q) from participating in electron transfer in the electron…

A: Electron transport chain is a chain of electron carriers present in the inner mitochondrial…

Q: Write a description of the physical characteristics of the isolated starch and glycogen. Provide the…

A: Starch and Glycogen are Polysaccharides, made up of many units of monosacharides. Starch is reserve…

Q: In the following structure, the carbon labeled [Select] carbon, the carbon labeled [Select] is…

A: Monosaccharides are the simplest units of sugars. All monosaccharides are either aldoses or ketoses.…

Q: All enzymes of the citric acid cycle are located in the mitochondrial matrix, except succinate…

A: Cellular respiration is the process how biochemical energy is generated from food. It involves the…

Q: II. Draw the different forms of the following amino acids in solution. 1. Proline (3 forms)

A: Since in the question, it is mentioned to write about the 3 forms of proline, only answer to that…

Q: Denatured protein is in a low energy state. What sort of explanation can you use to rationalize that…

A: Denaturation of protein: When proteins are denaturized, they lose the quaternary, tertiary, and…

Q: Show a calculation of change in standard reduction potential that explains why succinate is not…

A: When two half reactions are paired in a redox reaction, the half reaction with the higher E°' will…

Q: 1. Compute the concentration of the standard solutions by completing Table B.1. Report your answers…

A: Bradford assay is a method to estimate the protein concentration in the given sample. It is based on…

Q: 5. Reciprocal regulation of glycogen phosphorylase and glycogen synthase activity.

A: Enzymes are proteins that aid in the speeding up of chemical reactions. Enzymes bind to substrates,…

Q: 1. Acetyl-CoA labeled with ¹4C in both of its acetate carbon atoms is incubated with unlabeled…

A: The citric acid cycle, also called as the Tricarboxylic acid (TCA) cycle is the central metabolic…

Q: The structure given below represents what molecule? CHO I H-C-OH I CH₂OH dihydroxyacetone phosphate…

A: The molecular weight of glyceraldehyde, a pleasant, white, crystalline solid, is 90.08 g mol 1. 29…

Q: 1) Find the pH of 0.1 M of the differnet forms histidine species. (See image for equation and pKa…

A: Amino acids are building blocks of the proteins. Alpha carbon of amino acids consist of carboxyl…

Q: Which functional groups are present in digitoxin? a. To what lipid family does the complex ring…

A: Lipids are a chemically diverse group that have two things in common: low solubility in water and…

Q: Which of the following first messengers is hydrophobic and binds to a nuclear receptor protein…

A: The first messengers are extracellular biomolecules that bind to the cellular receptor and elicit a…

Q: Which of these is not a reducing sugar

A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified as monosaccharides,…

Question

Pls solve this question asap with proper explnantion, STRICTLY TO BE HANDWRITTEN

Which of the following reactions does not occur mammals?
pyruvate + NADH-lactate + NAD*
O ribulose-5-phosphoate ribose-5-phosphate
mannose + ATP-mannose-6-phosphate + ADP + P;
O 6-phophogluconate + NADP+ribulose-5-phosphate + NADPH + CO2
O pyruvate + NADH+H*CO₂ + ethanol + NAD+
eTextbook and Media.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

Which reaction is irreversible? oxidized glutathione + NADPH + H+ → reduced glutathione + NADP+ ribulose 5-phosphate → ribose 5-phosphate glucose 6-phosphate + NADP+ → 6-phosphoglucono-δ-lactone + NADPH + H+ sedoheptulose 7-phosphate + glyceraldehyde 6-phosphate → fructose 6-phosphate + erythrose 4-phosphate ribulose 5-phosphate → xylulose 5-phosphate
In which of the following metabolic conversions is ATP “generated” during glycolysis? Phosphoenolpyruvate -> pyruvate 2-Phosphoglycerate —> Phosphoenolpyruvate Glucose-6-phosphate —> Fructose-6-phosphate Fructose-1,6-bisphosphate —> Dihydroxyacetone phosphate + Glyceraldehyde-3-phosphate Fructose-6-phosphate —> Fructose-1,6-bisphosphate
Consider the following reaction of the glycolysis pathway. Which statement is NOT true regarding this reaction? P + C-H NADH + H+ NAD+ C-0-P H-C-OH H-C-OH Glyceraldehyde- CH₂0-P 3-phosphate dehydrogenase CH₂0-P 1,3-Bisphosphoglycerate Glyceraldehyde-3- phosphate O A one-carbon compound (1C) is converted into a two-carbon compound (2C). O It requires a coenzyme. O It is a redox reaction catalyzed by the enzyme glyceraldehyde-3-phosphate dehydrogenase. O It is a phosphorylation reaction.
Assuming that the glycerol 3-phosphate shuttle is operative, a complete oxidation of three molecules of glucose (by a eukaryotic cell) into carbon dioxide and water would produce approximately ATP molecules via oxidative phosphorylation only. (Consider NADH = 2.5 ATP and FADH2 = 1.5 ATP)
a Lactate dehydrogenase H H3C-C-COO- OH L-(+)-Lactase b Creatine kinase CH3 H₂N This is a(an) NH₂ Creatine + ATP Adenosine triphosphate This is a(an) ADP OOC-C-CH3 Adenosine diphosphate Pyruvate CH3 ON ồ Ò NH2 Y Phosphocreatine
The coenzyme NAD+ is required for which glycolytic reaction shown below? Oglyceraldehyde-3-P→ 1,3-bisphosphoglycerate glucose glucose-6-P fructose-6-P→ fructose-1,6-BP 2-phosphoglycerate → phosphoenolpyruvate
Which of the following is higher during high levels of glutathione reductase and NADP? SH A но (GSH) OH NH2 NH2 HO OH ;-CH-CH2-CH2-C-NH-CH–ċ–NH–CH2- CH2 В (GSSG) CH2 -CH-CH;-CH2=C-NH–C NH-CH–Ç-NH-CH2-C HO OH NH2
Glycerol backbone of a fat molecule can be converted to glyceraldehyde-3-phosphate, an intermediate in glycolysis. Assuming that the single glyceraldehyde-3-phosphate undergoes complete oxidation to CO₂, how many ATPs are produced by oxidative phosphorylation only (i.e. exclude ATPs from substrate level phosphorylation) from a single fat molecule? O 20 O 18 O 17 O 15 08
In which of the following metabolic conversions is ATP “generated” during glycolysis? Glucose —> Glucose-6-phosphate 1,3-Bisphosphoglycerate —> 3-Phosphoglycerate Fructose-1,6-bisphosphate —> Dihydroxyacetone phosphate + Glyceraldehyde-3-phosphate Glucose-6-phosphate —> Fructose-6-phosphate 2-Phosphoglycerate —> 3-Phosphoglycerate
How much ATP is produced from the complete B-Oxidation of myristic acid (C14H2802)? Activation of Fatty Acid ACCOA x (10 ATP/ACCOA) FADH₂ x (1.5 ATP/FADH₂) = NADH x (2.5 ATP/NADH) : = = -2 ATP ATP ATP ATP TOTAL ATP C18 CH, (CH₂)₁4-CH₂-CH₂-C-S-COA || FAD →FADH₂ CH₂(CH₂)₁4-CH=CH-C-S-CoA Each loop of the pathway represents a repetition of Steps 1-4. H₂O OH CH₂(CH₂)₁4-CH-CH₂-C-S-CoA || - NAD+ →→NADH+ H 0 CH3-(CH₂) 14 C-CH₂-C-S-CoA 0 || C16 CH₂(CH₂)14-C-S-CoA COA-SH Acyl CoA trans-Enoyl COA L-B-Hydroxyacyl CoA B-Ketoacyl COA H₁-C-S- + CH₂-C-S-CoA Acetyl CoA New acyl COA C₁4+ Acetyl CoA C12+ Acetyl CoA CO+ Acetyl CoA Cg+ Acetyl CoA C + Acetyl COA C₁ + Acetyl COA 2 Acetyl COA
The enzyme is considered to be alan * ÇOO ÇOO Lactate dehydrogenase HO-C-H+ NAD C=0 + NADH + H CH: Pyruvate Lactate O Oxydoreductase O Isomerase O Hydrolase O Ligase O Dehydratase
Arsenate can replace inorganic phosphate in the reaction catalyzed by glyceraldehyde-3-phosphate dehydrogenase, causing glyceraldehyde-3-phosphate to be directly converted to 3-phosphoglycerate(NADH is still formed). Which of the following is absolutely true in case of arsenate poisoning -Glycolysis will stop - Glycolysis will still proceed with no net ATP gain - Glycolysis will not generate any form of energy - Glycolysis will still proceed, but with a net consumption of ATP - Glycolysis will proceed with lactate as end product