Which of the following relax twisting stress in DNA molecules? (Select all that apply.) Topoisomerase activity Positive supercoiling Methylation of uridines Nucleosome winding None of the above. Submit Answer Try Another Version 1 item attempt remaining
Q: Genetics Problem show the table and word In certain breeds of chickens, the allele "B" is…
A: A classic example of this complexity can be found in certain breeds of chickens, where two sets of…
Q: Describe the structure of the influenza virion. Explain how the form of the influenza genome enables…
A: The structure of the influenza virus particle, also known as the virion, is what enables it to…
Q: In the simple picture below we are focusing on the chromosomes. Notice that the chromosomes are…
A: Chromosomes are thread-like structures which are visible during cell division. Cell division is a…
Q: Question1: Describe the functions of at least 4 different cytoplasmic organelles? Also, explain the…
A: Organelles, also known as cytoplasmic organelles, are specialized structures that are present in…
Q: Discuss the processes involved in the digestion of food in vertebrates
A: The process of digestion in vertebrates involves four simple steps: ingestion, digestion,…
Q: Intro to Neuroscience Question Students are celebrating the end of the year and have gotten…
A: The situation displayed includes a reflex activity, which is a quick, automatic reaction to a…
Q: Is there any study that has been done with the herb Bai Zhi (Angelica root) in veterinary medicine?…
A: Bai Zhi (Angelica root) is a traditional Chinese medicine herb that has been used for centuries to…
Q: Search for the required information of this herb in veterinary medicine: - Bai Zhi (Angelica root)…
A: Bai Zhi, also known as Angelica Dahurica or Angelica root, is a plant native to East Asia,…
Q: In what ways are floral traits similar or different between hawkmoth and bat pollination syndromes
A: The transfer of pollen grain from male anther of a flower to the female stigma is known as…
Q: Which are the fittest individuals in a population? Are those that produce the largest number of…
A: One method of evolution is natural selection. More environment-adapted organisms have a higher…
Q: Draw a pair of antiparallel microtubules across the page. The following should be clarified or…
A: Cytoskeleton is a complex of protein filaments and tubules that are associated with providing…
Q: hemoglobin with different properties. Which of the following contributes to the varying 02 binding…
A: Hemoglobin is an iron containing protwun. The iron portion of the hemoglobin is called the heme and…
Q: If a cell with 24 chromosome pairs underwent meiosis, how many total chromatids would be in each…
A: The question particularly focuses on the method of meiosis, a sort of cell division that results in…
Q: Question: Define motor neurons and the properties of each type (upper and lower)
A: Motor neurons are like the messengers of our body's movement system.There are two types: upper motor…
Q: What are questions a research team hopes to answer about the Egyptian mummies and the mummification…
A: Mummification is the process involved in removing the internal organs and moisture from the body and…
Q: Which of the following statements ACCURATELY describe spinal cord organization. α-motor neurons are…
A: The spinal cord is the long bony structure made up of nervous tissue that connects the brain with…
Q: Intro to Neuro Question: Huntington’s disease causes too much ballistic movement due to which of the…
A: Huntington's disease is characterized by the degeneration of neurons in the striatum, particularly…
Q: To describe: The ways by which membrane proteins associate with the lipid bilayer.
A: The main structural components of the plasma membrane are: Phospholipids form lipid bilayer:…
Q: In the glutamate-glutamine cycle, which of the following occurs? Glutamate and GABA are released by…
A: The glutamate-glutamine cycle is a crucial metabolic pathway that occurs in the central nervous…
Q: 11 If 0.1 ml of a 10-3 dilution of a culture is plated out and 65 colonies appear after incubation,…
A: Colony factor unit (CFU) is a unit used to estimate the total count of viable microbes in a given…
Q: Calculate the transpiration rate for the grape leaf above with a leaf surface area of 18 cm2. Air…
A: Transpirtation is the process by which plants lose their water. By this process they remove excess…
Q: A geneticist is using a three-point testcross to map three linked Drosophila recessive mutations…
A: In our analysis of genetic mutations, it is imperative to calculate recombination frequencies to…
Q: 1- The following Wild Type DNA codes for color in a lizard living in the Namib Desert (tan sand) a…
A: In the unique ecological setting of the Namib Desert, the interplay between an organism's physical…
Q: Imagine you are a botanist and you recently discovered a new species of plant in the unexplored…
A: This answer discusses the use of fluorescence microscopy techniques to investigate the efficiency of…
Q: This is not a mechanisms for microevolution: Mutation Gene flow Having a small population size that…
A: Evolution can be described as a modification in the inherited characteristics of organisms in a…
Q: Neuroscience: Describe motor cortex maps and the effects of damage to the motor cortex Please…
A: Motor neurons are like the messengers of our body's movement system.There are two types: upper motor…
Q: v a two-state model of a muscle sarcomere - representing relaxed and contracted forms. are your…
A: Muscle fibre consists of A and I bands. These bands are formed due to the regular parallel and…
Q: List two advantages of using sequence analysis of ribosomal components in classification?
A: An essential step in all living things is protein synthesis, which is carried out by cellular…
Q: The diagram represents DNA that is part of the RNA-coding sequence of a transcription unit. The…
A: Transcription is a process of formation of the RNA transcript from DNA sequence. Enzyme involved in…
Q: Explain the concepts of specificity and associativity in hippocampal LTP in 2-4 sentences.
A: Synapses are the junctions between neurons where electrical signals are transmitted. They are…
Q: Using the techniques described in this chapter carefully read through the case study and determine…
A: For this situation study, we are given the clinical history of a 73-year-old male patient, Winston…
Q: Describe the type of movement and musculature in the following invertebrates using the table below.…
A: The Animals who don't have backbone are known as invertebrates.. They do not have any bones in their…
Q: What cross will result in half homozygous dominant offspring and half heterozygous offspring? What…
A: Gene is the basic structural unit of heredity. Genes are present in DNA. DNA acts as genetic…
Q: state the biological significance of the results from graph. If the results deviated significantly…
A: Hypotheses are statements of proposed explanations of a phenomenon based on its observation.…
Q: A woman who has blood type A positive has a daughter who is type O positive and a son who is type B…
A: Blood group is the type of antigen present on the surface of blood cells ( Red blood cells) and type…
Q: Order: 1000 mL D5 1/2NS IV to run over 12 hours a) ML/hr b) Macrodrip (15 gtt/mL) c) Microdrip (60…
A: The infusion rate is the rate at which a fluid or medication is administered through an intravenous…
Q: e possible genotypes and phenotypes together that proves the answer.
A: To determine all the possible parental phenotypes for the ABO, MN, and Rh blood group traits, we can…
Q: Bb. na are also ca a. What is the probability that they will have a child affected with CF?…
A: Monohybrid crosses occur when only one characteristic at a time is taken into consideration whereas…
Q: In the graph below, a drug that was inhibitory would cause Membrane potential (mV) +40- 0- -40- -60-…
A: In the graph, you provided, a drug that was inhibitory would cause the membrane potential to be more…
Q: set of true breeding white cows were crossed with true breeding black cows to produce all brown…
A: In this type of cross, if there was complete dominance shown then in the F1 ratio the dominant…
Q: ETC/OP.
A: Electron Transport Chain:It is a critical process in cellular respiration that occurs in…
Q: Here is the question: Question Intro to Neuroscience Question: Students are celebrating the end of…
A: Your answer seems quite coorect.
Q: Which of the following statements about DNA strands is true? (You may choose more than one.) Group…
A: The process of creating an RNA copy of a gene's DNA sequence is known as transcription in the…
Q: This video refers to Denisovans as a “Ghost Lineage.” In fact, Denisovans don’t even have a formal…
A: A type specimen is a single physical specimen that is designated as the representative of a…
Q: What artifacts were present in the grave of Burial Yakovlevka? Describe what they might be and where…
A: The question relates to the artifacts found within the grave of Burial Yakovlevka. Artifacts found…
Q: Intro to Neuro: Which hormone is released by the testes but not by the ovaries? Group of answer…
A: The question is about a very interesting field of science called endocrinology, which studies the…
Q: Question 1: Compare and contrast at least four medical imagining techniques in terms of their…
A: “Since you have posted multiple questions, we will provide the solution only to the first question…
Q: In 2-3 paragraphs (must be typed) explain: Discuss the regulation of cholesterol synthesis.
A: Cholesterol synthesis is a complex process that is tightly regulated by a variety of factors,…
Q: Draw a relaxed and contracted sarcomere and label the parts of the Z-discs, thick and thin…
A: The tightening, decreasing, or lengthening of muscles during an activity is known as muscular…
Q: 1. Which of the following is not a biohazard? a used hypodermic syringe moldy bread or cheese…
A: A biohazard refers to a biological substance or agent that poses a threat to the health and safety…
Please answer fast i give upvote
Trending now
This is a popular solution!
Step by step
Solved in 4 steps
- Molecules of DNA Polymerase III per Cell vs. Growth Rate It is estimated that there are 40 molecules of DNA polymerase III per E. coli cell, is it likely that the growth rate of E. coli is limited by DNA polymerase III availability?O Off target effects are not really a concern. Question 20 What happens after a double stranded break is induced in the DNA? Select the statement that is FALSE. O HR which will lead to a small indel if template DNA is absent O Microhomology-Mediated End Joining O Non-Homologous End Joining O HR if template DNA is present Question 21 See below for four STR profiles from four different boys, as depicted in an electropherogram. The peak localTransforming an Animal In order to create the transgenic cow, your lab first needs to create a DNA vector containing the insulin gene. This step involves a considerable amount of scientific terminology. Make sure you understand the meaning of key terms. Match the following terms with their correct definitions. | ampicillin resistance gene 5 restriction site 6 Origin of replication 7 Ligase 2 promoter 3 Xhol Ч ехоn is a region of DNA that is not transcribed. is the location in the plasmid that is recognized by the restriction enzyme Xhol. is an enzyme that joins DNA fragments together. is the location on the plasmid where DNA replication begins. is a region of DNA that initiates transcription of a gene. is an restriction enzyme that looks for the sequence TCGA. is a gene that enables you to identify bacterial cells that have taken up the plasmid.
- Topoisomerases can cut phosphodiester bonds and the DNA ligases will have to seal the nicks whenever there is a need to relieve the supercoiling. True FalseTable 1 shows a list of restriction endonucleases with their recognition sequence and the sites of cleavage indicated by arrows. Table 1 Enzyme name Recognition sequence and position of cut 5'GIAATTC3 5'G!GATCC3' 5'GIGTACC3 5'GCIGGCCGC3' 5'IGATC3' 5'GGTACIC3' 5'ALGATCT3 EcoRI ВатHI Аcс651 Notl Sau3A Kpnl BglII (i) Which restriction enzyme(s) produce blunt ends? (ii) Are there any pair of neoschizomers in the list? Explain. (iii) Are there any pair of isocaudomers in the list? Explain.Why is the company Qiagen has more refined DNA extraction steps than a normal Strawberry DNA extraction practical? Summary of Qiagen DNA extraction steps Add ATL buffer and grind with sample. Add 20 microliters of enzyme Proteinase K to degrade protein into a 1.5-2ml microcentrifuge tube. Add 200 microlitres AL lysis buffer, and mix by vortexing for 5–10 seconds, which breaks cell membrane allowing DNA to be released. Incubate the sample at 56 degrees for 10 minutes. Mix the cell lysate with 200 microlitres ethanol by pipetting it at the side of the microcentrifuge wall so DNA precipitates. The DNA forms a white layer and the remaining liquid is discarded. Pipet the mixture into DNeasy Mini spin column placed in a 2 ml collection tube. Centrifuge for a minute at 8000 rpm. Place the mini spin column into a 2 ml collection tube, add 500 µl Buffer AW1, and centrifuge for 1 min at 8000 rpm. Then add it to a new 2 ml collection tube (provided), add 500 µl Buffer AW1, and centrifuge for 1…
- Extreme UV exposure leads to the SOS response in bacteria. By what mechanism does the SOS response function? Answer choices induction of photolyase and the addition of white light to remove the thymine dimer destruction of lexA, which leads to expression of an alternate, error-prone DNA polymerase homologous recombination repair non-homologous end joining exinuclease removal of a segment of DNA including a thymine dimer, followed by the replacement of DNA using the complementary strand of DNA#4 BamI --- 5’ CCTAG ↓G 3’ 5’ ACGCCTAGGACGTATTATCCTAGGTAT CCGCCGCCGT CATCA 3’ 3’ TGCGGATCCTGCATAATAGGATCCATAGGCGGCGGCAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:Choose reactions that always require hydrolysis of ATP. Select all that apply. sliding along template strands unwinding of DNA strands by helicase formation of the phosphodiester linkage by DNA ligase unwinding of DNA strands by B2 subunits formation of the phosphodiester linkage by DNA polymerase I
- Hello, I would really appiarte help appreciate help. This is a blank question so I am unsure why it was rejected immeditely the first time. Thank you in advance. Identify the type of mutation and how it would affect the protein made (amino acid) if the following changes occurred in the DNA antisense strand First codon change from TAC to TAT. Third codon change from ACG to ACA. Ninth nucleotide changes from G to T. Nucleotide with adenine (A) base inserted between 3rd and 4th nucleotide. Types of Mutation Changes in the Amino Acid 1. 2. 3. 4.vvnicn the following statements are correct about the repair of a DNA duplex containing the sequence below that is grown INE coli (select all that apply)? Strand A Strand B GATCTAGCCGGCATCCGAT CTAGATCGGACGTAGGCTA Methyl ✔A. MutH cleaves Strand A O B. DNA repair will result in the bold A in strand B being replaced with a C O C. DNA repair will result in the bold G in strand A being replaced with a T ✔ D. Defect will not be properly repaired in dam(-) E coli O E. The mammalian repair system would also correct the mismatch shown based on the methylation status of the DNAGiven the following double-stranded fragment of DNA: 5'- ACTTGGCAGGCCTTCGATCC-3' 3'- TGAАССGTCСGGAAGCTAGG-5' A hypothetical restriction endonuclease recognizes a 6bp sequence with two-fold symmetry (typical for restriction enzymes) found in this fragment and catalyzes cleavage of this DNA on both strands between GG nucleotides within the recognition sequence. This nuclease exhibits b-type cleavage (atypical for restriction enzymes). Draw the double-stranded sequence of each fragment after cleavage showing any phosphates left on the ends.