Give typed full explanation Horsetails are non-flowering vascular plants. During the sporophytestage of a horsetail's lifecycle, its spores are produced in thestrobilus located at the top of the plant, as shown in the diagram.branchesrhizome-strobilusleavesnodeUse the passage to answer the question.Which of these events is most likely to result in the generation of a newspecies of horsetail?OOA. triploidy in the sporophyteB. triploidy in the gametophyteC. point mutation in the sporophyteD. point mutation in the gametophyte

Horsetails, a kind of non-flowering vascular plant, have a fascinating evolutionary history that…

Which of these events is most likely to result in the generation of a new species of horsetail? A. triploidy in the sporophyte B. triploidy in the gametophyte C. point mutation in the sporophyte D. point mutation in the gametophyte

Which of these events is most likely to result in the generation of a new species of horsetail? A. triploidy in the sporophyte B. triploidy in the gametophyte C. point mutation in the sporophyte D. point mutation in the gametophyte

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter23: Protists

Section: Chapter Questions

Problem 2VCQ: Figure 23.25 Which of the following statements about Paramecium sexual reproduction is false? The...

See similar textbooks

Related questions

Q: Two other Labradors mate and produce puppies. Their genotypes are Bbee and bbEe. What color are…

A: Labrador or Labrador retrievers are a breed of dogs developed in the UK from the retriever gun dog.…

Q: Question 8 Myoglobin and the subunits of hemoglobin have: O very similar primary and tertiary…

A: Hemoglobin is an iron-containing protein, present on the surface of RBCs and carries oxygen from…

Q: For each of the following false statements, change the statement to make it true and explain your…

A: Due to the hydrophobic interior of membranes, the passage of polar and charged molecules is not…

Q: A new predator is introduced into boomer fox forest. It feeds on both morphs equally and is very…

A: Relative fitness, in the context of evolutionary biology, is a measure of an organism's ability to…

Q: Match the terms and definitions below to the appropriate location on the image above. Mental…

A: The human cranium is a complex structure that serves to ensure the brain and support the structures…

Q: The snapdragon flower in Tennessee and Alabama are both white. When these two strains of snapdragon…

A: In complementary gene interaction, two different genes (in this case, alleles) interact in a way…

Q: The paddle-like, charged transmembrane domains of potassium channels may confer ion selectivity to…

A: The first question is about the role of the paddle-like, charged transmembrane domains of potassium…

Q: You are planting a cherry orchard with two rows of female fruiting trees. Below is a diagram of…

A: Plants that possess both the male reproductive part (stamen) and female reproductive part (pistil)…

Q: the Mode of Inheritance (MOI) exercises. Focus on determining the values in the colored cells. Your…

A: The data are generated from an initial parental cross. One parent displays the disease phenotype and…

Q: all of the correct answers. Diffusion is a process that: [mark all correct answers] a. occurs in…

A: Diffusion is a passive process that is a process of transportation of molecules. It may also occur…

Q: f you breed fast box turtles and use midparent-midoffspring regression to determine that the…

A: In the world of breeding and genetics, the idea of heritability performs a critical position in…

Q: *The normal color of snapdragons is red. Some pure lines showing variation in flower color hav been…

A: The inheritance of flower colors in snapdragons is a classic genetic study that provides insights…

Q: The clamshell orchid can have a dorsal sepal that is either bright purple (P) or yellow (Y), and may…

A: This question involves the principles of Mendelian genetics, specifically the concepts of dominance,…

Q: What is the total yield of NADH + H+ from cellular respiration through the Krebs cycle for one…

A: Aerobic cellular respiration consists of 4 steps-1. In the first step glucose is converted into…

Q: When an ATP molecule is hydrolyzed in cells, it is quickly recycled back into ATP so that it can be…

A: Weight of the person 65kg = 65000 gmSo, the weight to ATP be hydrolysis and regenerate=65000gmATP in…

Q: TERMS BOX Endothermic Exothermic Catabolic Terms that describe this reaction Spontaneous Terms that…

A: Living organisms show metabolic activities in their cells that are responsible for maintaining the…

Q: Which of the following definitions are adequate as genus and differentia definitions and which are…

A: In the study of definitions and meaning, it’s crucial to understand the concept of genus and…

Q: dioxide ₂0 Water 235 {{{ Sunlight energy enters ecosystem Photosynthesis in chloroplasts converts…

A: In nature carbon dioxide is being fixed by the green plants by Calvin cycle of photosynthesis. This…

Q: When intracellular concentrations phosphofructokinase to be ( Main Content ats) to be OA) low, low…

A: Aerobic respiration is the process of cellular respiration in which various respiratory substrates…

Q: Using the word bank below, fill in the blanks in the diagram with the correct part of the cycle. •…

A: All living organisms, including plants and animals, depend on the nitrogen cycle, a natural…

Q: Refer to the graph. current Ion current Inward Outward current A researcher conducts a voltage clamp…

A: This question is about a voltage clamp experiment conducted on a giant squid axon. The voltage clamp…

Q: In recent years, strains of bacteria resistant to antibiotics have created serious health care…

A: Antibiotics are the medications that are used for suppressing the growth of bacteria or killing…

Q: Graphing. Applying the Scientific Method, and Scientific Writing Practice Problem #3

Q: the Mode of Inheritance (MOI) exercises. Focus on determining the values in the colored cells. Your…

A: The data are generated from an initial parental cross. One parent displays the disease phenotype and…

Q: Read the study in the picture and answer the following questions. 1. List the specific strengths and…

A: Specific Strengths of the Study:Case-Control Design: The study used a case-control approach, which…

Q: Why is there an upper limit on how large cells can become? Large cells have a small volume…

A: Cell is the basic structural and functional unit of life. A cell is defined as the aqueous…

Q: What are three public health measures that could reduce the probability that bacteria will develop…

A: Antibiotic resistance has become a serious public health problem. Antibiotics are medications that…

Q: CASE ANALYSIS Case: An 81 year old female brought in by her son for a medication evaluation. Her…

A: In this case, the patient is an 81-year-old female with a complicated restorative history and an…

Q: Figure 2.25 Ocean acidification. CÓ, HO H₂CO H₂CO₂H+ HCO3 HACO HCOS CO₂ + Ca CaCO₂ Scientific Skills…

A: This question is about interpreting a scatter plot with a regression line from an experiment that…

Q: Label each level of DNA packaging in the eukaryotic chromosome with the appropriate term. Supercoil…

A: Nucleic acids are biomolecules composed of repeating monomer units. There are two types of nucleic…

Q: When subculturing some fibroblast primary cell culture; you encountered a problem that the cells…

A: During the process of cell adhesion, cells interact and link with one another via specialized…

Q: Which of the following statements about lipids in membranes is FALSE? O Membrane curvature may be…

A: Lipids are pivotal components of cell membranes, impacting membrane structure and function.…

Q: Certain cells in your pancreas make digestive enzymes that are secreted into ducts and carried to…

A: The pancreas is an abdominal organ located behind the stomach, surrounded by the spleen, liver, and…

Q: 1 ㅇㅁㅁㅇ ㅇㅁㅇㅁ

A: Inheritance pattern is a pattern which determines how traits are passed from parent generation to…

Q: Which of the following is not a property of homologous chromosomes? They pair physically during…

A: When a mother cell divides into two or more daughter cells, a parent cell has undergone the process…

Q: What occurs during each of the phases of growth ?

A: Plant growth is the process by which a plant increases in size and develops from a seedling to…

Q: Q1. The total area of a haemocytometer chamber is. a) 1 mm² b) 15 mm² c) 16 mm² d) 9 mm²…

A: A hemocytometer is a tool that counts the total number of cells in blood or other biological bodily…

Q: Compare and contrast mitosis and meiosis by constructing a table of similarities and differences.…

A: A cell cycle is the sequence of events that occur in a cell as it develops and divides into daughter…

Q: is to say, the excitatory pathways become over ive, or the inhibitory pathways, esigned to temper…

A: Normally neuron has a resting membrane potential of about -70 millivolt. When an action potential…

Q: Which of the following is true about cystic fibrosis (CF) and the CFTR transporter protein? CFTR is…

A: CFTR or cystic fibrosis transmembrane conductance regulator is a glycoprotein and belongs to the ABC…

Q: 2. Dosage compensation in mammals typically involves the random inactivation of one of the two X…

A: Black male (XbY): Can produce two types of gametes, Xb and Y."Calico" female (XBXb): Can produce two…

Q: There are two color morphs in boomer foxes (not a real species), red and gray. Both tend to have a…

A: The ability of an organism to survive, reproduce, and pass on genetic traits to the next generation…

Q: 4. The interactions on the backbone (not the side chains) contribute to the (circle one):…

A: A protein is a polymer which is formed by a monomer amino acids that are linked together by peptide…

Q: Describe the importance of the nitrogen and carbon cycles and the role of microbes in their…

A: Note:- Sorry, since you have posted multiple questions, as per the honor code, we will solve the…

Q: ● Describe functions of pili Explain how flagellar motility and chemotaxis enable bacteria to…

A: They are prokaryotic, meaning they lack a true nucleus and membrane-bound organelles. Bacteria play…

Q: Indicate which of the following are true about ribosomes. There may be more than one correct answer.…

A: The small, spherical, non-membranous cytoplasmic organel present in both prokaryote and eukaryotic…

Q: This pedigree (below) shows inheritance of a genetic disorder in a family. Assume the trait is rare.…

A: Gene is the segment of DNA responsible for heredity. Two or more alternative forms of genes…

Q: Compare stained cells to that of cancerous human colon cells in the pictures shown

A: Cancer results from uncontrolled cell division. The mechanism inside the cell that regulates the…

Q: Cellular senescence is a process that is exaggerated in malignant cells and promotes their division…

A: Malignant cells, scientifically referred to as neoplastic or cancerous cells, are abnormal cells…

Q: Given the following DNA sequence: 5'ATTGGCTGTTAAAACCGGTGCCTGGGCATCGTTGGA3' Part A Write the mRNA…

A: The DNA or deoxyribonucleic acid is the genetic material in living organisms. DNA contain genes that…

Concept explainers

Embryology

Question

Give typed full explanation

Horsetails are non-flowering vascular plants. During the sporophyte
stage of a horsetail's lifecycle, its spores are produced in the
strobilus located at the top of the plant, as shown in the diagram.
branches
rhizome
-strobilus
leaves
node
Use the passage to answer the question.
Which of these events is most likely to result in the generation of a new
species of horsetail?
O
O
A. triploidy in the sporophyte
B. triploidy in the gametophyte
C. point mutation in the sporophyte
D. point mutation in the gametophyte

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1: Introduction:

VIEW

Step 2: Explanation for the incorrect options:

VIEW

Solution

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

In fungi, asexual spores are produced by_________ celldivision and have__________ set(s) of chromosomes.Sexual spores are produced by________ cell divisionin a(n)_______ and have_________ set(s) ofchromosomes.
Amoeba multiplies by mitotic cell division .is theis phenomena growth or reproduction explain?
Label the diagram which features an illustration of a portion of the sporophyte of Selaginella with strobili, and a photomicrograph of the longitudinal section of a mature strobilus. Indicate whether each of the structure you identified is haploid (n) or diploid (2n)
When the Ascomycetes fungus reproduces sexually, mating type A fungi cross fertilize mating type a fungi. The resulting zygotes undergo meiotic and then mitotic division to produce asci with eight ascospores. The ascospores in the asci are ordered and reflect the position of the parental nuclei in the zygote. Use the passage to answer the question. How is the life cycle of Ascomycetes different from that of humans? A. Haploid cells undergo meiosis. B. Haploid cells undergo mitosis. C. Diploid cells undergo meiosis. D. Diploid cells undergo mitosis.
When the hyphae of two compatible club mushrooms (Basidiomycota) fuse, the result is hyphae that is; Diploid N + N Соenocytic Нaploid
SporophytesA. are diploidB. are produced by sporesC. produce next generation sporophytesD. produce gametes by meiosis Ulva sporophyte reproductive cellsA. become four zoosporesB. produce zoospores by meiosis and mitosisC. become 8 or 16 biflagellate gametesD. none of the above
fern nrothalli.... antheridia and archegonia. Student Preparation Read text Chapter 16, pages 366-390. Figure 1: Alternation of Generations Mitosis Spores 60 - + - + Meiosis One cell from Sporophyte undergoes meiosis Gametophytes Haploid multicellular individuals 1n 2n saldy Quisetum, and at least one fern - Gamete + Gamete Fertilization Sporophyte Diploid multicellular individual 1. Are these thalli the gametopytes or sporophytes?_ 2. Are the thalli haploid or diploid? Mitosis Exercise I Marchantiophyta: The Liverworts Examine with the dissecting microscope the thalli of the relatively large, dichotomously branching gametophytes of Marchantia 3. Are any gemma cups containing gemmae present on your plant? 4. What is the function of gemmae?. 78 Zygote Examine carefully with the dissecting microscope the additional liverworts that are available. Note the dichotomous branching, the midrib-like region, and the air pores on the upper (dorsal) surface. 5. How is dichotomous branching…
Diagram of alternation of genertaion I = zygote (2n) II = sporophyte Y = fertilization? But can I have some help to confirm about hte rest?
When the Ascomycetes fungus reproduces sexually, mating type A fungi cross fertilize mating type a fungi. The resulting zygotes undergo meiotic and then mitotic division to produce asci with eight ascospores. The ascospores in the asci are ordered and reflect the position of the parental nuclei in the zygote. Use the passage to answer the question. Based on the diagram, how many unique ascospores are produced in each ascus resulting from the cross fertilization of two Ascomycetes fungi? A. 1 B. 2 C. 4 D. 8
Both antheridia and archegonia are on the same gametophyte. Is the gameto-phyte dioecious or monoecious?
spores are ready to disperse; they protect B. Equisetum - live specimen and pp. 424-427 1. What Phylum does this plant belong to? 2. Is the plant you see haploid or diploid/gametophyte or sporophyte? 3. How did Calamites (p. 400) differ from the horsetails we have today?
In same species of Asteraceae and grasses, seed are formed without fusion of gametes. Mention the scientific term for such form of reproduction.