With reference to Table 2, what was the total extract volume in mL? Enter a number (no decimal places)
Q: Which of the following will occur if there is an increase in enzyme or substrate concentration? in...
A: Enzymes increase the rate of biochemical reactions by decreasing the activation energy. Activation e...
Q: Explain what is meant by “stereospecificity.”
A: Specificity is the key term in biochemistry mainly in the study of enzymes. It is the ability of an ...
Q: 10. Fatty acids containing double bonds are found in ________. a. polysaccharides. b. proteins. c. s...
A: DISCLAIMER: Since you have asked multiple questions, we have solved the first question for you. If y...
Q: 8. In a separate enzyme happyase experiment using [Et] = 10 nM, the reaction velocity is measured at...
A: The [s] in the experiment is as follows:
Q: Assume you have a long polypeptide chain of Gly-Val dipeptides linked end to end. Explain the likel...
A: Proteins have four levels of the structural organization including Primary, secondary, tertia...
Q: . Rifampin binds to bacterial RNA polymerase. b. Streptomycin binds bacterial ribosomes, disabling ...
A: The answer of the following question is given below.
Q: (A) Do electron transport chains create a gradient so that ATP synthase can generate ATP molecules? ...
A: ATP synthase is a mitochondrial enzyme machinery which is located in the inner membrane of mitochond...
Q: 2. Glycosidic bond is sucrose is this answer. Explain in 2-3 sentences why you chose
A: Sucrose can be defined as a type of dissacharide. It comprises one unit of glucose and fructose resp...
Q: What are the products of the following transamination reaction? a-ketoglutarate + alanine O glutamat...
A: Amino acids are the building blocks of proteins which are composed of amino group (NH3+), carboxyl g...
Q: Please explain the theoretical background (positive color reactions and what is being detected) invo...
A: Proteins are the polymers of amino acids. The amino acids are joined together by the peptide bonds. ...
Q: 10. What would happen if one of the monomers at location D was changed to glutamic acid? Briefly exp...
A: Amino acids are the building blocks of proteins. There are 20 amino acids which make up numerous pro...
Q: Why is the position of Cys 58 important in 3GRS(GLUTATHIONE REDUCTASE)? When Cys 58 is mutated to ...
A: Dear Students, I have downloaded the PDB ID 3GRS structure from https://www.rcsb.org/ This is the st...
Q: Differentiate direct and indirect ISE method of sodium determination. 2. What will happen to the re...
A: Sodium is an important electrolyte of blood that is analysed for checking water and electrolyte bal...
Q: The G° of the reaction of reactant X to product Y is the same in its catalytic reaction and the unca...
A: A catalyzed reaction means the reaction is catalyzed by the enzyme. Uncatalyzed reaction means the r...
Q: Which of the following is the result of the hydrolysis of 5'-CTAGTTC-3' at the a side? ...
A: Nucleic acids are composed of nucleotides. Nucleotides are composed of a phosphate group, a pentose ...
Q: In man, there is gradation in eye color and resulting to 9 phenotypes. These are (in order of the nu...
A: Dark brown eyed child and hazel eyed will be there in the progeny. Hazel eye color is most likely to...
Q: Briefly explain the consequence of the following structures.
A: Plasma membrane is a protective layer of the cells. Plasma membrane allows the movement of molecules...
Q: Respiratory paralysis. Tabun and sarin have been used as chemical-warfare agents, and parathion has ...
A: Biological warfare, often known as germ warfare, is the intentional deployment of biological toxins ...
Q: Explain the consequence of the following structures.
A: Every cell has a plasma membrane, and many of its organelles possess membranes as well. All membrane...
Q: What are the main structural features of the polysaccharides starch? How do this aids in its functio...
A: Plants store glucose as the polysaccharide starch. Starch can be separated into two fractions - amy...
Q: 8. Provide the structure of guanine, a heterocyclic base found in DNA. 9. Provide the structure of a...
A: Nucleic acids are biomolecules composed of nucleotides. Nucleotides are composed of a pentose sugar ...
Q: The proton-motive force drives the rotation of the Y subunit of ATP synthase. This creates conformat...
A: True. ATP synthase is a smllest rotary motor. Passage of H+ ions through the membrane embedded porti...
Q: 1.) What nitrogenous base would not be expected in structure C? 2.) What nitrogenous base would not ...
A: Hi! Thanks for your question. As you have posted multiple questions and have not mentioned which o...
Q: What is oxidative degradation in catabolism? and what is reductive biosynthesis in anabolism?
A: Anabolic reactions lead to the synthesis of biomolecules. The catabolic reactions lead to the oxidat...
Q: 4. Which of the following best describe the physical properties of fatty acids? a. All physical prop...
A: The backbone of triacylglycerols is constituted of a glycerol moiety in which all the three hydroxyl...
Q: Hello, please directly answer the questions 1, 2, 3 and 4 1. Biological relationship between hydroge...
A: Enzymes are biological catalysts that are proteins. Chemical reactions are sped up with catalysts. S...
Q: What properties do all monosaccharides have?
A: Monosacharides are the class of carbohydrates which consists of simple sugars. They are building blo...
Q: What is the general name for a monosaccharides which has 6 carbons 5 carbons • 3 carbons
A: Carbohydrates are classified into three types on the basis of number of sugar units they contain whi...
Q: Explain how oxidizing an organic compound can fuel ATPproduction
A: ATP is popularly known as the energy currency of the cell. The high-energy phosphate bonds present i...
Q: Each of the cytochromes in the mitochondrion contains prosthetic groups. What is a prosthetic group?...
A: Conjugated proteins have prosthetic group with apoprotein. Apoprotein - The protein part of the conj...
Q: Find the Gibbs free energy of mixing when 2 moles of ethanol is mixed with 5 moles of water at a tem...
A: Given; n1= no. of moles of ethanol= 2 mol n2= no. of moles of ethanol= 5 mol T=27oC =273+27=300K ...
Q: 1. What are the main biological functions of polysaccharides?
A: A carbohydrate is a polysaccharide. It's a polymer made up of monosaccharide chains linked together ...
Q: Why do amino acids, when dissolved in water, become zwitterions?
A: Aminoacids are the building blocks of proteins consisting of both acidic and basic functional groups...
Q: 1.) What are the main structural features of the polysaccharides starch? 2.) How do this aid in its ...
A: Starch is a homopolysaccharide. It is the carbohydrate reserve of the plants. It is an important die...
Q: 8. Maltose is a reducing sugar because A. It is a monosaccharide B. It can be reduced C. It is a pen...
A: Carbohydrates are also known as hydrates of carbon. They contain elements such as carbon, hydrogen a...
Q: The end product of protein metabolism is often ammonia, a base. What effect will this have on pH, wi...
A: Ammonia is the end product of protein metabolism. Ammonia formed as the end product of protein metab...
Q: UDP , gemcitabine was shown to undergo two successive phosphorylations at . The product, gemcitabine...
A: GEMCITABINE is a chemotherapy medication, used to treat cancer such as breast cancer, testicular can...
Q: 1.What are the net products after one molecule of Glucose goes through the process of Glycolysis ? A...
A: Glycolysis is a process that occurs in the cytoplasm. Glycolysis can occur irrespective of the prese...
Q: What are the three major classes of carbohydrates? Describe each in one sentence
A: CARBOHYDRATES:- carbs, sugars molecules found in potatoes, rice, and many other food items. Empheric...
Q: How may genes play a role in the susceptibility of inheriting cancers? The reproductive system discu...
A: Cancer is a disease in which the body's cells grow out of control and spread to other tissues. Any o...
Q: Give 3 types of specificity of enzyme and an example for each. Example: Relative Specificty - α-amyl...
A: Enzymes are consist of amino acids, linked by peptide bond and it catalyzes the biochemical reaction...
Q: 4. What is the major biochemical function for each of the following proteins? a. a Keratin b. Collag...
A: Fibrous proteins are proteins that have cellular or extracellular roles in behaving as a robust stru...
Q: Why each (oxidation) FADH2 in the respiratory chain makes fewer ATP in comparison to oxidation of NA...
A: A widely accepted model for ATP synthesis is the binding change mechanism or flip-f...
Q: Please give the color of each analysis indicating positive result and substance formed causing the c...
A: Since we only answer up to 3 sub-parts, we’ll answer the first 3. Please resubmit the question and s...
Q: Choose any/all that apply to the citric acid cycle.
A:
Q: Numerous drugs are obtained from Glycosides. If you were to conduct a research using glycoside as ac...
A: Glycosides are described as chemicals in which one or more sugars are linked to non-sugar molecules ...
Q: Does your protein 3GRS have a quaternary structure??? talk about the tertiary structure of 3GRS. h...
A: All molecular models (atomic coordinate file) based on the X-ray crystallographic data of the struct...
Q: Describe the protein composition of gluten We all know gluten is composed of two types of proteins ...
A: Gluten is defined as the rubbery mass that remains when wheat dough is washed so as to remove the st...
Q: IV. Write on the first column the monosaccharide unit(s) that is present in the given disaccharide. ...
A: Carbohydrates, abbreviated as carbohydrates, are sugar molecules. Saccharides are another name for s...
Q: Hair is made of protein. The protein is a structural protein called α-keratin, which contains many d...
A: Amino acids are organic molecules having an amino group and an acid group. Amin...
With reference to Table 2, what was the total extract volume in mL? Enter a number (no decimal places)
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Drag the labels onto the diagram to identify the anatomical terminology describing body orientation and direction (human a Posterior (caudal) Distal Superior (dorsal) Proximal Inferior (caudal) Anterior (ventral) Posterior (dorsal) Pearson archWhat is the method of MS protein quantification presented here? Please answer very soon will give rating surely Complete Answer neededE Classwork for BTMF_Itani_ Biolo X E SI'ERRA STANLEY - protein-synth X arch 8 period light reaction - Google S x ocs.google.com/document/d/1plhyciPrM-AMsQKmaUHZSZU44EJL85jDuCyDxE01E60/edit LEY-protein-synthesis-worksheet_practice-converted ☺ Insert Format Tools Add-ons Help Last edit was 5 minutes ago 100% Normal text Noto Sans . BIUA 12 川, 三= + - I 1. 2 . 4. 5 PART C. Use your codon chart to determine the amino acid sequence. Remember to read through the strand and ONLY start on AUG and STOP when it tells you to stop. Follow example below: Example: DNA O AGA CGG TAC CTC CGG TGG GTG CTT GTC TGT ATC CTT CTC AGT ATC mRNA O UCU GCC AUG GAG GCC ACC CÁC GAA CAG ACA UAG GAA GAG UCA UAG protein 0 start - glu – ala -thre - hist – asp -glu-threo-stop acid acid 1. DNA → CCT CTT TAC ACA CGG AGG GTA CGC TAT TCT ATG ATT ACA CGG TTG CGA TCC ATA ATC MRNA → protein → 2. DNA → AGA ACA TAA TAC CTC TTA ACA CTC TAA AGA CCA GCA CTC CGA TGA ACT GGA GCA MRNA → protein → 围 Sign out Co & 6. 7
- A Classwork for BTMF_Itani_ Biolo x A S'ERRA STANLEY -protein-synth X O 8 period light reaction - Google S x google.com/document/d/1plhyciPrM-AMsQKmaUHZSZU44EJL85jDuCyDxE01E60/edit - protein-synthesis-worksheet_practice-converted O sert Format Tools Add-ons Help TUR Last edit was 10 minutes ago 0% Normal text Noto Sans BIUA 川。 三E▼=、三三 13 + 田回▼ 1 3 4. 5 8. DNA → TAC AGA CGG CAA CTC TGG GTG CTT TGT TCT CTT CTC AGT ATC mRNA → protein > Son out Co 4. 6. 8. 9.File guft 1.yt Machine Cochise14ee7 Lane 0 Pmer. DTarPOPD mob Comment 17703 Spacing 15.06 Siga C 17A 4 G 2 Bases 0 an 2004 Gelstat ime123 219 20 30 60 70 NNACTCA TCTOGTGGA TTC CTA TCCTG AC A AG TGATGTG CAAAC TG GTAACTC TG AG GCAGATAAC CA G GG CA AA AAGGTG TATAAG 100 110 140 100 CAGA AG TC CGGA AA A TCA TT TAA 170 TAAA ACA AAGCCCTAACT TG GAAG AAGT TCA GTTTTACACA TCT TTA TA TG GAGAGAA 180 TAT TCTAT TA ATOTCCTGT TA TATT TG TCA TATTCA TA CAGT TGTCACAGTATATT TCAAAC CA AC TG TTTAAAA ACAAAC TO AAATAAA 210 230 240 260 270 AAATTTAAATACCCT TA TG TA AA ATAG GCT TC CC TG GTG GCTCAG GG GTAAAAA ACTCGC CCGC CA ACGCAG GAGATGTAGAT TTGATC CCT 300 310 340 350 410 430 440 GG GT TAG GA AG icCCTa GAGA AGGAAATGAAAAAC CACTCTAG TAT TCT Tac CTG GG AAATC CCA TGGACAG AG GAGCOTO GAG G Gc 490 500 SI0 530 TACAGTCCATGGGAGTCGCAA A AGAGT TG GACATG ACTAA ACA ACAACATATAAAATAACCT TACTC CATAATGTCAAACT TATOTCACAC S40 AAA ATGCAA AGT TCT TACATCTAT TAACTTTTATGOT TAAATATA ACCTAATGCACTOTTT TATACAGCA ACAACTACT TT TT TATTT TAAA…Profiles Tab Window Help History Bookmarks urrayst x L Starred - Google Drive 9 Preparing and Maintaining Your x A My Course - Basic Biochemistr x + anlearning.com/courses/88da82a2-ed4e-42bf-a342-fbb181eaf3ce/5/nb73xh/tools/assessment/items/6a486586-b4c2-4ee8-b 93.5% Resources -x Give Up? O Hint Combine these amino acids into a tripeptide. Add or remove atoms and bonds as needed. Select Draw Rings More Érase +H -H Reset Drawing H H H H H C - o-- H N - C -C - 0 - H C - O-- H H H. CH, H,C H CH, H,C CH, 10 W
- d/e/1FAIpQLSfTle9UfP15_VUqFI-ACEQd1XBykXv5Lr4dEMQbLJ1d6fCupw/viewform Students subjected three samples of five different molecules to gel electrophoresis as shown in Figure 1 A B C DE +2 3 Wells 4 8. Which of the following statements best explains the pattern seen on the * gel with regard to the size and charge of molecules A and B? 1 point molecules A and B are positively charged, and molecule A is smaller than molecule B. molecules A and B are positively charged, and molecule A is larger than molecule B. molecules A and B are negatively charged, and molecule A is smaller than molecule B. molecules A and B are negatively charged, and molecule A is larger than molecule B. Sign outmead. Post Lab #2 Smear & Stain Preparation Name: Leidiawa MontaNo Date: 1. Why are thick or dense smears less likely to provide a good smear preparation for microscopic evaluation? Please explain. Becapse, it will diminish the amount ds latcan Pass through by mam 1t difficult to See under the micioscol e, s less liket to Prowde a go image. 2. What could potentially happen if you leave the slide exposed for too long to the open flame? Why do you have to be careful? we can form ring Patterns if we expose the slide for ta0 the flame 3. During the preparation of a smear leading into simple staining of the bacterial culture S. epidermidis you forgot to heat fix the slide. What would you see on this slide as compared to a slide that was properly prepared? Please explain. 4. You partner stained bacterial cells and saw only the background and not the actual cell was stained. Your partner thought this was a mistake. Please explain what type of staining method this is, how it works and why the…jmaplindex.html?_con%3Dcon&external_browser-D0&launchUrl=https%253A %252Fnewconnect.mheducation.com%.. Saved Help Save & Exit Sub A drug is supplied as 2-g powder for injection, which will be mixed in enough water to make 20 ml of final solution (W/V) Select the volume that should be added to a 100-ml IV bag in order to administer 200 mg of a drug intravenously to the patient. Multiple Cholce 1 ml 2 ml 3 ml 4 ml Prey 18 of 20 Next > EPIC rw MacBook Pro
- Protein isolation and Purification Technique Isolation techniques Centrifugation Salting out Isoelectric precipitation Chromatographic techniques Gel filtration lon exchange Affinity HPLC SPE Electrophoretic techniques Native PAGE SDS-PAGE Tricine-SDS-PAGE Isoelectric focusing Western blotting Principle of separation[protein] volume [protein] [protein] in to Sample Lysate in "gel- load 5 in 20 protein in Name volume assay* lysate ready" ul sample protein 3.9 2 µl Hg/ml Tilapia 19.9 10 μι Hg/ml 18.2 2 µl Hg/ml Cod >20 14 10 μι Hg/ml 9.4 15 2 µl ug/ml Sole >20 6. 10 μι ug/ml > >apa format no plagiarism Describe the FDA approval process for assessing the safety and efficacy of a newly developed drug. What are advantages and disadvantages of this process?