Prescott's Microbiology
11th Edition
ISBN: 9781260211887
Author: WILLEY, Sandman, Wood
Publisher: McGraw Hill
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 1.2, Problem 1MI
MICRO INQUIRY Why ore the probionts pictured above not considered cellular life?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
I pis
Walden Pond 5: While you were collecting your pond samples, you were troubled by the organism
seen below, which was continually biting you:
Domain and Kingdom?
[ Choose ]
can this organism act as an "arthropod
vector" of microbial pathogens?
[Choose]
uestion 51
Seal
thermophiles
halophites
Archaea
methanogens
Animals
nonphotosynthetic
eukaryotes
Fungi
ancestral
amoebozoa
eukaryotic
original
cell
cell
brown algae
photosynthetic
eukaryotes
red algae
Protists
green algge
Plants
purple bacteria
photosynthetic bacteria
Eubacteria
other bacteria
past
present
Figure 2 A simplified phylogenetic tree of the six kingdoms
Domains of Life
In 1996, Carl Woese conducted a detailed analysis of living organisms. He revealed
that all organisms could be classified into three distinct groups. TIhese groups, called
12
éty
Suppose that one of Pasteur's swan neck flasks had broken, such that the neck came off. What would be the likely result?
Maggots would have appeared on the meat
The broth would have remained sterile
Bacteria would not have been isolated in pure culture
The animalcules would have escaped
The liquid would have become contaminated
You have a mixture of bacteria, archaea, fungi, protists, and algae. Which of the following would be most definitive in determining which of these cells are archaea?
Size in a bright field microscope
Structure in a scanning electron microscope
Fluorescence in situ hybridization
Super resolution microscopy
Simple staining
Chapter 1 Solutions
Prescott's Microbiology
Ch. 1.1 - Prob. 1MICh. 1.1 - MICRO INQUIRY How many of the taxa listed in the...Ch. 1.1 - Retrieve, Infer, Apply 1. How did the methods used...Ch. 1.1 - Prob. 2CCCh. 1.2 - MICRO INQUIRY Why ore the probionts pictured above...Ch. 1.2 - MICRO INQUIRY Why does the branch length indicate...Ch. 1.2 - Prob. 1CCCh. 1.2 - Retrieve, Infer, Apply 2. Explain the...Ch. 1.2 - Prob. 3CCCh. 1.2 - Prob. 4CC
Ch. 1.3 - Prob. 1CCCh. 1.3 - Prob. 2CCCh. 1.3 - Prob. 3CCCh. 1.3 - Prob. 4CCCh. 1.3 - Retrieve, Infer, Apply 2. How did Winogradsky and...Ch. 1.4 - Retrieve, Infer, Apply 3. Briefly describe the...Ch. 1.4 - Prob. 2CCCh. 1.4 - Retrieve, Infer, Apply 5. List all the activities...Ch. 1 - Prob. 1RCCh. 1 - Prob. 2RCCh. 1 - Compare, Hypothesize, Invent 2. Why arent viruses,...Ch. 1 - Compare, Hypothesize, Invent 4. Would microbiology...Ch. 1 - Compare, Hypothesize, Invent 5. Some individuals...Ch. 1 - Compare, Hypothesize, Invent 10. Support this...Ch. 1 - Prob. 5AL
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Microbiology Why are mycobacterium (mycobacterium sp) harder to control than other bacteria?arrow_forwardDESCRIPTION Why was the - Golden Age of Microbiology - pivotal for advances in health & human well being and what role(s) did Louis Pasteur play in it?arrow_forwardBioluminescence can only be functionally important if detected by other organisms. What are two reasons that dinoflagellates may emit bioluminescence?arrow_forward
- Could someone help me with this bio question? Explain how fungi and protists are both beneficial and deadly to humans?arrow_forwardWhich aspects of the biology of Nanoarchaeum equitans make itespecially interesting from an evolutionary point of view?arrow_forwardDistinguish between morphology and arrangement of bacteria cells please explain well and do not copy from google or i will downvote. please explain, do not enumerate onlyarrow_forward
- What is the importance of the diversification and proliferation of bacteria inthe ancient aquatic environment? How does it relate to animalmulticellularity? please do not copy from googlearrow_forwardMis Paramecium Prepared slide Conjugation Magnification: X 100 List one advantage and one disadvantage of conjugation in Paramecium: Advantage: Paramecium Prepared slide Fission Magnification: 40DX Disadvantage: LAB 3 PROTISTSarrow_forwardAs a review, compare the four major groups of pathogenic protozoaaccording to overall cell structure, locomotion, infective state, andmode of transmission.arrow_forward
- What structure in the cell is the target for fluorescent probes inphylogenetic FISH?arrow_forwardQUESTION 10 You grow this weird looking organism in lab and have no idea what it is. You decide to sequence its genome and one of the reads you get back is shown below: >UnknownSequence1 GCGGTATTTGACGCCGCATTCGAAGTGGTCGATCCATTCGGCGTATCAGGACAATTTGCATATGTTGACGTTGTCGCGGGGTGGGCCCTCGATCTGGATGTCGGAGCGGGACGCG GCGAAGATCGGTGTGGCCGATAATGATTGGATCGAGGCGGTCAATCGTAACGGGGTGGTGGTGGCGCGGGCGATCGTGTarrow_forwardINTRODUCTION OF METABARCODING OF YEAST ASSOCIATED WITH SEAWEED IN MARINE ENVIRONMENTarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
What Is A Virus ? ; Author: Peekaboo Kidz;https://www.youtube.com/watch?v=YS7vsBgWszI;License: Standard YouTube License, CC-BY