Suppose a triplet on the template strand of a piece of DNA has the sequence 5′-ATA-3′. What would be the consequences if the sequence were mutated to GTA? TTA? GCA? Explain your answer in each case.

Question

Want to see more full solutions like this?

Answer 1

Textbook Question

Chapter 18, Problem 18.1CC

Suppose a triplet on the template strand of a piece of DNA has the sequence 5′-ATA-3′. What would be the consequences if the sequence were mutated to GTA? TTA? GCA? Explain your answer in each case.

Expert Solution

Summary Introduction

To determine: The consequences if a sequence 5ʹ-ATA-3ʹ on template strand of DNA has been mutated to GTA.

Introduction: The specific sequences which are present on template strand of DNA (Deoxyribose nucleic acid) in the form of triplet codons will transmit the information for the formation of messenger RNA (Ribose nucleic acid) and proteins.

Explanation of Solution

When a sequence of 5ʹ-ATA-3ʹ on template strand of DNA has been mutated to GTA, it will lead to the formation of messenger RNA having triplet codons UAC in 3' to 5' direction. It occurs because if ATA was present, the resulting messenger RNA would be UAU. Therefore, due to the mutation, UAC will code for amino acid tyrosine similar to UAU because of both UAU and UAC code for amino acid tyrosine.

(b)

Expert Solution

Summary Introduction

To determine: The consequences if a sequence 5ʹ-ATA-3ʹ on template strand of DNA has been mutated to TTA.

Introduction: The specific sequences which are present on template strand of DNA (Deoxyribose nucleic acid) in the form of triplet codons will transmit the information for the formation of messenger RNA (Ribose nucleic acid) and proteins.

Explanation of Solution

When a sequence of 5ʹ-ATA-3ʹ on template strand of DNA has been mutated to TTA, it will lead to the formation of messenger RNA having triplet codons UAA in 3' to 5' direction. It occurs because if ATA was present, the resulting messenger RNA would be UAU. Therefore, due to the mutation, UAA will code for stop codon instead of tyrosine that would be coded by UAU.

(c)

Expert Solution

Summary Introduction

To determine: The consequences if a sequence 5ʹ-ATA-3ʹ on template strand of DNA has been mutated to GCA.

Introduction: The specific sequences which are present on template strand of DNA (Deoxyribose nucleic acid) in the form of triplet codons will transmit the information for the formation of messenger RNA (Ribose nucleic acid) and proteins.

Explanation of Solution

When a sequence of 5ʹ-ATA-3ʹ on template strand of DNA has been mutated to GCA, it will lead to the formation of messenger RNA having triplet codons UGC in 3' to 5' direction. It occurs because if ATA was present, the resulting messenger RNA would be UAU. Therefore, due to the mutation, UGC will code for amino acid cysteine instead of tyrosine that would be coded by UAU.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Students have asked these similar questions

Suppose a single-nucleotide polymorphism occurred in the original strand to make the change shown below. Would this affect the resulting protein? Explain. This is the original strand TGG CGA GAG GGG AGC AGC TGG TAT CGC TGG GCC CAA AGG TCT TCA GGG AAT GCC This is the strand with the SNP. (The change is shown in red.) TGG CGA GAG GGG AGC AGC TAG TAT CGC TGG GCC САА AGG TCT TCA GGG AAT GCC Suppose a different single-nucleotide polymorphism occurred in the original strand to make the change shown below. Would this affect the resulting protein? Explain. This is the original strand AGG TCT TCA GGG AAT GCC TGG CGA GAG GGG AGC AGC TGG TAT CGC TGG GCC САА This is the mutated strand. (The change is shown in red). AGG TCT TCA GGG AAT GCC TGG CGA GAG GGA AGC AGC TGG TAT CGC TGG GCC CAA

in the human gene for the beta chain of hemoglobin, the first 30 nucleotides in the amino acid coding region is represented by the sequence 3'TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? If the DNA duplex for the beta chain of hemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region.

Which of the following set(s) of primers a-d could you use to amplify the following target DNA sequence, which is part of the last protein-coding exon of the CFTR gene? Explain briefly. (Note: The three dots represent the body of the region to be amplified, whose beginning and end are only being shown.) 5' GGCTAAGATCTGAATTTTCCGAG . TTGGGCAATAATGTAGCGCCTT 3' 3' CCGATTCTAGACTTAAAAGGCTC . AACCCGTTATTACATCGCGGAA 5' a. 5' GGAAAATTCAGATCTTAG 3'; 5' TGGGCAATAATGTAGCGC 3' b. 5' GCTAAGATCTGAATTTTC 3'; 3' ACCCGTTATTACATCGCG 5' c. 3' GATTCTAGACTTAAAGGC 5'; 3' АССCGTTATTАСАТСGCG 5 d. 5' GCTAAGATCTGAATTTTC 3'; 5' TGGGCAATAATGTAGCGC 3'

Answer 2

Textbook Question

Chapter 18, Problem 18.1CC

Suppose a triplet on the template strand of a piece of DNA has the sequence 5′-ATA-3′. What would be the consequences if the sequence were mutated to GTA? TTA? GCA? Explain your answer in each case.

Expert Solution

Summary Introduction

To determine: The consequences if a sequence 5ʹ-ATA-3ʹ on template strand of DNA has been mutated to GTA.

Introduction: The specific sequences which are present on template strand of DNA (Deoxyribose nucleic acid) in the form of triplet codons will transmit the information for the formation of messenger RNA (Ribose nucleic acid) and proteins.

Explanation of Solution

When a sequence of 5ʹ-ATA-3ʹ on template strand of DNA has been mutated to GTA, it will lead to the formation of messenger RNA having triplet codons UAC in 3' to 5' direction. It occurs because if ATA was present, the resulting messenger RNA would be UAU. Therefore, due to the mutation, UAC will code for amino acid tyrosine similar to UAU because of both UAU and UAC code for amino acid tyrosine.

(b)

Expert Solution

Summary Introduction

To determine: The consequences if a sequence 5ʹ-ATA-3ʹ on template strand of DNA has been mutated to TTA.

Introduction: The specific sequences which are present on template strand of DNA (Deoxyribose nucleic acid) in the form of triplet codons will transmit the information for the formation of messenger RNA (Ribose nucleic acid) and proteins.

Explanation of Solution

When a sequence of 5ʹ-ATA-3ʹ on template strand of DNA has been mutated to TTA, it will lead to the formation of messenger RNA having triplet codons UAA in 3' to 5' direction. It occurs because if ATA was present, the resulting messenger RNA would be UAU. Therefore, due to the mutation, UAA will code for stop codon instead of tyrosine that would be coded by UAU.

(c)

Expert Solution

Summary Introduction

To determine: The consequences if a sequence 5ʹ-ATA-3ʹ on template strand of DNA has been mutated to GCA.

Introduction: The specific sequences which are present on template strand of DNA (Deoxyribose nucleic acid) in the form of triplet codons will transmit the information for the formation of messenger RNA (Ribose nucleic acid) and proteins.

Explanation of Solution

When a sequence of 5ʹ-ATA-3ʹ on template strand of DNA has been mutated to GCA, it will lead to the formation of messenger RNA having triplet codons UGC in 3' to 5' direction. It occurs because if ATA was present, the resulting messenger RNA would be UAU. Therefore, due to the mutation, UGC will code for amino acid cysteine instead of tyrosine that would be coded by UAU.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 3

Textbook Question

Chapter 18, Problem 18.1CC

Suppose a triplet on the template strand of a piece of DNA has the sequence 5′-ATA-3′. What would be the consequences if the sequence were mutated to GTA? TTA? GCA? Explain your answer in each case.

Expert Solution

Summary Introduction

To determine: The consequences if a sequence 5ʹ-ATA-3ʹ on template strand of DNA has been mutated to GTA.

Introduction: The specific sequences which are present on template strand of DNA (Deoxyribose nucleic acid) in the form of triplet codons will transmit the information for the formation of messenger RNA (Ribose nucleic acid) and proteins.

Explanation of Solution

When a sequence of 5ʹ-ATA-3ʹ on template strand of DNA has been mutated to GTA, it will lead to the formation of messenger RNA having triplet codons UAC in 3' to 5' direction. It occurs because if ATA was present, the resulting messenger RNA would be UAU. Therefore, due to the mutation, UAC will code for amino acid tyrosine similar to UAU because of both UAU and UAC code for amino acid tyrosine.

(b)

Expert Solution

Summary Introduction

To determine: The consequences if a sequence 5ʹ-ATA-3ʹ on template strand of DNA has been mutated to TTA.

Introduction: The specific sequences which are present on template strand of DNA (Deoxyribose nucleic acid) in the form of triplet codons will transmit the information for the formation of messenger RNA (Ribose nucleic acid) and proteins.

Explanation of Solution

When a sequence of 5ʹ-ATA-3ʹ on template strand of DNA has been mutated to TTA, it will lead to the formation of messenger RNA having triplet codons UAA in 3' to 5' direction. It occurs because if ATA was present, the resulting messenger RNA would be UAU. Therefore, due to the mutation, UAA will code for stop codon instead of tyrosine that would be coded by UAU.

(c)

Expert Solution

Summary Introduction

To determine: The consequences if a sequence 5ʹ-ATA-3ʹ on template strand of DNA has been mutated to GCA.

Introduction: The specific sequences which are present on template strand of DNA (Deoxyribose nucleic acid) in the form of triplet codons will transmit the information for the formation of messenger RNA (Ribose nucleic acid) and proteins.

Explanation of Solution

When a sequence of 5ʹ-ATA-3ʹ on template strand of DNA has been mutated to GCA, it will lead to the formation of messenger RNA having triplet codons UGC in 3' to 5' direction. It occurs because if ATA was present, the resulting messenger RNA would be UAU. Therefore, due to the mutation, UGC will code for amino acid cysteine instead of tyrosine that would be coded by UAU.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 4

Textbook Question

Chapter 18, Problem 18.1CC

Suppose a triplet on the template strand of a piece of DNA has the sequence 5′-ATA-3′. What would be the consequences if the sequence were mutated to GTA? TTA? GCA? Explain your answer in each case.

Expert Solution

Summary Introduction

To determine: The consequences if a sequence 5ʹ-ATA-3ʹ on template strand of DNA has been mutated to GTA.

Introduction: The specific sequences which are present on template strand of DNA (Deoxyribose nucleic acid) in the form of triplet codons will transmit the information for the formation of messenger RNA (Ribose nucleic acid) and proteins.

Explanation of Solution

When a sequence of 5ʹ-ATA-3ʹ on template strand of DNA has been mutated to GTA, it will lead to the formation of messenger RNA having triplet codons UAC in 3' to 5' direction. It occurs because if ATA was present, the resulting messenger RNA would be UAU. Therefore, due to the mutation, UAC will code for amino acid tyrosine similar to UAU because of both UAU and UAC code for amino acid tyrosine.

(b)

Expert Solution

Summary Introduction

To determine: The consequences if a sequence 5ʹ-ATA-3ʹ on template strand of DNA has been mutated to TTA.

Introduction: The specific sequences which are present on template strand of DNA (Deoxyribose nucleic acid) in the form of triplet codons will transmit the information for the formation of messenger RNA (Ribose nucleic acid) and proteins.

Explanation of Solution

When a sequence of 5ʹ-ATA-3ʹ on template strand of DNA has been mutated to TTA, it will lead to the formation of messenger RNA having triplet codons UAA in 3' to 5' direction. It occurs because if ATA was present, the resulting messenger RNA would be UAU. Therefore, due to the mutation, UAA will code for stop codon instead of tyrosine that would be coded by UAU.

(c)

Expert Solution

Summary Introduction

To determine: The consequences if a sequence 5ʹ-ATA-3ʹ on template strand of DNA has been mutated to GCA.

Introduction: The specific sequences which are present on template strand of DNA (Deoxyribose nucleic acid) in the form of triplet codons will transmit the information for the formation of messenger RNA (Ribose nucleic acid) and proteins.

Explanation of Solution

When a sequence of 5ʹ-ATA-3ʹ on template strand of DNA has been mutated to GCA, it will lead to the formation of messenger RNA having triplet codons UGC in 3' to 5' direction. It occurs because if ATA was present, the resulting messenger RNA would be UAU. Therefore, due to the mutation, UGC will code for amino acid cysteine instead of tyrosine that would be coded by UAU.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 5

Textbook Question

Answer 6

Textbook Question

Answer 7

Expert Solution

Summary Introduction

To determine: The consequences if a sequence 5ʹ-ATA-3ʹ on template strand of DNA has been mutated to GTA.

Introduction: The specific sequences which are present on template strand of DNA (Deoxyribose nucleic acid) in the form of triplet codons will transmit the information for the formation of messenger RNA (Ribose nucleic acid) and proteins.

Explanation of Solution

When a sequence of 5ʹ-ATA-3ʹ on template strand of DNA has been mutated to GTA, it will lead to the formation of messenger RNA having triplet codons UAC in 3' to 5' direction. It occurs because if ATA was present, the resulting messenger RNA would be UAU. Therefore, due to the mutation, UAC will code for amino acid tyrosine similar to UAU because of both UAU and UAC code for amino acid tyrosine.

(b)

Expert Solution

Summary Introduction

To determine: The consequences if a sequence 5ʹ-ATA-3ʹ on template strand of DNA has been mutated to TTA.

Introduction: The specific sequences which are present on template strand of DNA (Deoxyribose nucleic acid) in the form of triplet codons will transmit the information for the formation of messenger RNA (Ribose nucleic acid) and proteins.

Explanation of Solution

When a sequence of 5ʹ-ATA-3ʹ on template strand of DNA has been mutated to TTA, it will lead to the formation of messenger RNA having triplet codons UAA in 3' to 5' direction. It occurs because if ATA was present, the resulting messenger RNA would be UAU. Therefore, due to the mutation, UAA will code for stop codon instead of tyrosine that would be coded by UAU.

(c)

Expert Solution

Summary Introduction

To determine: The consequences if a sequence 5ʹ-ATA-3ʹ on template strand of DNA has been mutated to GCA.

Introduction: The specific sequences which are present on template strand of DNA (Deoxyribose nucleic acid) in the form of triplet codons will transmit the information for the formation of messenger RNA (Ribose nucleic acid) and proteins.

Explanation of Solution

When a sequence of 5ʹ-ATA-3ʹ on template strand of DNA has been mutated to GCA, it will lead to the formation of messenger RNA having triplet codons UGC in 3' to 5' direction. It occurs because if ATA was present, the resulting messenger RNA would be UAU. Therefore, due to the mutation, UGC will code for amino acid cysteine instead of tyrosine that would be coded by UAU.

Answer 8

Expert Solution

Summary Introduction

To determine: The consequences if a sequence 5ʹ-ATA-3ʹ on template strand of DNA has been mutated to GTA.

Introduction: The specific sequences which are present on template strand of DNA (Deoxyribose nucleic acid) in the form of triplet codons will transmit the information for the formation of messenger RNA (Ribose nucleic acid) and proteins.

Explanation of Solution

When a sequence of 5ʹ-ATA-3ʹ on template strand of DNA has been mutated to GTA, it will lead to the formation of messenger RNA having triplet codons UAC in 3' to 5' direction. It occurs because if ATA was present, the resulting messenger RNA would be UAU. Therefore, due to the mutation, UAC will code for amino acid tyrosine similar to UAU because of both UAU and UAC code for amino acid tyrosine.

Answer 9

Expert Solution

Answer 10

Expert Solution

Answer 11

Expert Solution

Answer 12

Summary Introduction

To determine: The consequences if a sequence 5ʹ-ATA-3ʹ on template strand of DNA has been mutated to GTA.

Introduction: The specific sequences which are present on template strand of DNA (Deoxyribose nucleic acid) in the form of triplet codons will transmit the information for the formation of messenger RNA (Ribose nucleic acid) and proteins.

Answer 13

Explanation of Solution

When a sequence of 5ʹ-ATA-3ʹ on template strand of DNA has been mutated to GTA, it will lead to the formation of messenger RNA having triplet codons UAC in 3' to 5' direction. It occurs because if ATA was present, the resulting messenger RNA would be UAU. Therefore, due to the mutation, UAC will code for amino acid tyrosine similar to UAU because of both UAU and UAC code for amino acid tyrosine.

Answer 14

(b)

Expert Solution

Summary Introduction

To determine: The consequences if a sequence 5ʹ-ATA-3ʹ on template strand of DNA has been mutated to TTA.

Introduction: The specific sequences which are present on template strand of DNA (Deoxyribose nucleic acid) in the form of triplet codons will transmit the information for the formation of messenger RNA (Ribose nucleic acid) and proteins.

Explanation of Solution

When a sequence of 5ʹ-ATA-3ʹ on template strand of DNA has been mutated to TTA, it will lead to the formation of messenger RNA having triplet codons UAA in 3' to 5' direction. It occurs because if ATA was present, the resulting messenger RNA would be UAU. Therefore, due to the mutation, UAA will code for stop codon instead of tyrosine that would be coded by UAU.

Answer 15

(b)

Expert Solution

Answer 16

(b)

Expert Solution

Answer 17

Expert Solution

Answer 18

Summary Introduction

To determine: The consequences if a sequence 5ʹ-ATA-3ʹ on template strand of DNA has been mutated to TTA.

Introduction: The specific sequences which are present on template strand of DNA (Deoxyribose nucleic acid) in the form of triplet codons will transmit the information for the formation of messenger RNA (Ribose nucleic acid) and proteins.

Answer 19

Explanation of Solution

When a sequence of 5ʹ-ATA-3ʹ on template strand of DNA has been mutated to TTA, it will lead to the formation of messenger RNA having triplet codons UAA in 3' to 5' direction. It occurs because if ATA was present, the resulting messenger RNA would be UAU. Therefore, due to the mutation, UAA will code for stop codon instead of tyrosine that would be coded by UAU.

Answer 20

(c)

Expert Solution

Summary Introduction

To determine: The consequences if a sequence 5ʹ-ATA-3ʹ on template strand of DNA has been mutated to GCA.

Introduction: The specific sequences which are present on template strand of DNA (Deoxyribose nucleic acid) in the form of triplet codons will transmit the information for the formation of messenger RNA (Ribose nucleic acid) and proteins.

Explanation of Solution

When a sequence of 5ʹ-ATA-3ʹ on template strand of DNA has been mutated to GCA, it will lead to the formation of messenger RNA having triplet codons UGC in 3' to 5' direction. It occurs because if ATA was present, the resulting messenger RNA would be UAU. Therefore, due to the mutation, UGC will code for amino acid cysteine instead of tyrosine that would be coded by UAU.

Answer 21

(c)

Expert Solution

Answer 22

(c)

Expert Solution

Answer 23

Expert Solution

Answer 24

Summary Introduction

To determine: The consequences if a sequence 5ʹ-ATA-3ʹ on template strand of DNA has been mutated to GCA.

Introduction: The specific sequences which are present on template strand of DNA (Deoxyribose nucleic acid) in the form of triplet codons will transmit the information for the formation of messenger RNA (Ribose nucleic acid) and proteins.

Answer 25

Explanation of Solution

When a sequence of 5ʹ-ATA-3ʹ on template strand of DNA has been mutated to GCA, it will lead to the formation of messenger RNA having triplet codons UGC in 3' to 5' direction. It occurs because if ATA was present, the resulting messenger RNA would be UAU. Therefore, due to the mutation, UGC will code for amino acid cysteine instead of tyrosine that would be coded by UAU.