1. A linear DNA molecule is subjected to complete restriction digestion by (1) EcoR1 alone, (2) BamHI alone, and (3) both enzymes together. The fragments are run on a gel. Results are shown below: EcoR1 BamH1 both 10 kb 9 kb 8 kb 5 kb 2 kb 1 kb (a) How long is the original DNA molecule? (b) How many EcoR1 recognition sites does it have? (c) Does the longest EcoR1 fragment contain a BamH1 restriction site? ( :n) II ||

1. A linear DNA molecule is subjected to complete restriction digestion by (1) EcoR1 alone, (2) BamHI alone, and (3) both enzymes together. The fragments are run on a gel. Results are shown below: EcoR1 BamH1 both 10 kb 9 kb 8 kb 5 kb 2 kb 1 kb (a) How long is the original DNA molecule? (b) How many EcoR1 recognition sites does it have? (c) Does the longest EcoR1 fragment contain a BamH1 restriction site? ( :n) II ||

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter10: Biotechnology

Section: Chapter Questions

Problem 1CT

See similar textbooks

Similar questions

A linear DNA molecule is subjected to complete restriction digestion by (1) EcoRI alone, (2) HindIII alone, and (3) both enzymes together. The DNA fragments are then separated using gel electrophoresis. Results are shown below: (i) (ii) (iii) EcoRI Hindill Both | | — | | 10 kb 9 kb 8 kb 5 kb 2 kb 1 kb How long is the original DNA molecule? How many EcoRI recognition sites does it have? Does the longest EcoRI fragment contain a HindIII restriction site? Explain your answer.
EcoRI recognizes G A-A-T-T-C sequence and cleave/ cut between G and A. How will the DNA fragments look like if EcoRI is used for the DNA below? How many fragments are produced? 5- AAAGATTTGAATTTCGAATTCAATTTAAGAATTCCCTTAGAATTTCC -¹3
#16) The restriction enzymes Xhol and SalI cut their specific sequences as shown below: XhoI 5' C | TCGAG 3' SalI | 5' GTCGAC 3' 3' GAGC | TC 5' 3' G | AGCTG 5' Can the sticky ends created by XhoI and SalI sites be ligated? If yes, can the resulting sequences be cleaved by either XhoI or SalI?
Refer to the succeeding diagram of two DNA samples (A, B) with the specific restriction enzyme (RE) recognition sites marked with arrows. A spontaneous mutation (insertion) occurred in DNA sample A and introduced an additional restriction site. RE site RE site RE site RE site ↓↓ ↓ A RE site RE site RE site ↓ B Design two (2) DNA probes to be used in RFLP analysis involving these two DNA samples. Draw/illustrate the region(s) in the DNA molecule which you will use as reference (homologous) sequences in the design of the probes, THAT - a. Will reveal RFLP polymorphism between the DNA samples after probe detection/visualization; and b. Will not reveal RFLP polymorphism between the DNA samples c. Illustrate and briefly explain the expected result from this RFLP marker analysis. (Assume that the DNA probe is labelled with 32P radioactive isotope).) [answer in maximum 5 sentences ONLY]
When joining two or more DNA fragments, a researcher can adjust the sequence at the junction in a variety of subtle ways, as seen in the following exercises.(a) Draw the structure of each end of a linear DNA fragment produced by an EcoRI restriction digest (include those sequences remaining from the EcoRI recognition sequence).(b) Draw the structure resulting from the reaction of this end sequence with DNA polymerase I and the four deoxynucleoside triphosphates.(c) Draw the sequence produced at the junction that arises if two ends with the structure derived in (b) are ligated (d) Draw the structure produced if the structure derived in (a) is treated with a nuclease that degrades only single-stranded DNA.(e) Draw the sequence of the junction produced if an end with structure (b) is ligated to an end with structure (d).(f) Draw the structure of the end of a linear DNA fragment that was produced by a PvuII restriction digest (include those sequences remaining from the PvuII recognition…
Chimeric DNA true are all except - a) Formed by linking DNA fragments of unrelated 2ood l v genome b) Sticky end producing restriction endonucleases favour formation of chimeric DNA c) They don't require DNA ligases d) The organism harbouring a chimeric DNA has features of themselves and the properties of the insert
The following diagram shows one-half of a restriction site. (a) Draw the other half. GAC G I C (b) Use heavy arrows (↑1) to identify type II cleavage sites that would yield blunt-ended duplex DNA products. (c) Use light arrows (T1) to identify type II cleavage sites yielding staggered cuts that could be converted directly to recombinant DNA molecules by DNA ligase, with no other enzymes involved. (d) If this were the recognition site for a type I restriction endonu- clease, where would cutting of the duplex occur? (e) If DNA sequences were completely random, how large an inter- val (in kilobase pairs) would you expect between identical copies of this sequence in DNA?
1) The DNA fragment shown in Figure 1 is cleaved by the restriction enzyme EcoRI as indicated. The number in parenthesis shows the position of the cleavage site. The total length of the DNA fragment is 4000 bp. Small parts of the DNA sequence is known as shown. 5' ACCCTAGGTGTGACCGCGATCCGGCAGCATAAT 3' EcoRI (400) EcoRI (1300) EcoRI (3800) 3' CGCGAAATGCTTTAAGCGCTCTACGGGAGGG5' 3'AGCGTTAGAGTAGCCGGTAAAGGGTACGCGCCTTAA 5' Figure 1: DNA fragment with a total length of 4000 bp. The figure below depicts a gel on which marker DNA of known size has been run. Sketch the location of the bands that will appear, if the DNA fragment shown in Figure 1 is cleaved by EcoRI and afterwards run on the gel along with the marker DNA. 6000 5000 4000 3000 2000 1000 800 600 500 400 200
A) For this DNA fragment (from 5' to 3') "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATTCCCGGTATA", what is its complementary strand B) What are the products when the DNA with the above sequence is incubated with the restriction enzyme EcoRI C) What are the products when the DNA with the above sequence is incubated with the restriction enzyme Mspl D) Draw the first two (2) base pairings of the DNA molecule from the 5' end and label all key elements of the molecule including the bonds involved
If a 500 bp of DNA between the two restriction sites were deleted, how would the banding pattern on the gel differ from the one you drew in part a? (PART A WITH THE FIRST PART OF THE QUESTION IS ATTACHED)
HgaI recognizes a specific 5 bp sequence. How frequently would you expect a specific 5 bp sequence to be found in any genome, considering that there are 4 possibilities for each of the 5 nucleotides in the restriction site sequence?
1) Restriction enzymes come in a concentration of U/ml, and it is recommended that 1U be used for each ug of DNA to be digested. If an enzyme you want to use comes in at 22,000 U/ml, and you want to digest 5 ug of DNA. How much volume will you have to use for the reaction and how will you be able to measure it with the pipettes we have in the lab? 2) An enzyme for ligation (Cip) comes at a concentration of 16000 units/ml. How many units will there be in 10 ul?