2. Human activity can be very disruptive to an ecosystem. Part of the forest shown in the picture was clear-cut for timber harvesting. Will this forested area change via primary or secondary succession? Explain.

Q: a. Briefly describe the pharmacokinetics of inhaled nicotine. Would you expect  pharmacokinetics of…

A: Nicotine is a naturally produced alkaloid in the nightshade family of the plants . It is widely used…

Q: How is it possible that we are able to identify correlations between phenotype and some patterns of…

A: Phenotypes, which comprise an organism's appearance, growth, and behavior, are the observable…

Q: 47. Expansion of the extracellular fluid volume leads to an increase in the plasma concentration of…

A: Whenever the extracellular volume is decreased, Anti Diuretic Hormone, aldosterone, and angiotensin…

Q: List human input-output channels and discuss briefly about it.

A: A human interacts with the outside world through sending and receiving information, often known as…

Q: Instructions: Put the following terms into a word map to explain how they are interrelated for DNA…

A: DNA replication is a complex process of producing copies of the entire chromosome using the…

Q: BasH II Kpnl Dra TTGTAAAACGACGGCCAGTGAGCGCGCGTAATACGACT…

A: Many people agree that one of the 20th century's most significant contributions to molecular biology…

Q: What is the probability that Mike is carrier? 1/6 1/4 1/3

A: Answer The probability will be 1/4   Reason : As both of the parents phenotypically but their family…

Q: Fill in the blanks.  Blanks with the same letter are the same molecule.       Molecules to use:…

A: Water is necessary for transpiration, photosynthesis, and respiration in order for plants to grow…

Q: Empathy in prairie voles: Is this the consolation prize?

A: Empathy: Empathy is defined as the ability to understand other people's feelings and emotions. Some…

Q: Describe the stages of meiosis.

A: Introduction  Meiosis is a unique form of germ cell division that creates gametes, such as sperm or…

Q: Phylogenetic hypothesis 1 requires. changes, whereas hypothesis 2 requires Hypothesis I Hypothesis…

A: Phylogeny represents evolutionary relationship between taxons. It is used to find the evolutionary…

Q: Gradient ascent search is prone to local optima just like hill climbing. Describe how you might…

A: In numerical analysis, hill climbing is a mathematical optimization technique that belongs to the…

Q: (iii) (iv) What are the three (3) main cycles in PCR? Discuss the processes at each PCR cycle…

A: Polymerase Chain Reaction ( PCR) is a technique used to make millions or billions of copies of the…

Q: Which enzyme is used for catalyzing the phosphorylation of glucose as well as the phosphorylation of…

A: Cellular respiration is a phenomenon in which glucose is used and of liberation of ATP takes place .…

Q: Question is related to natural sciences. What is natural science? 2. Discuss the value of studying…

A: Understanding, predicting, and describing natural occurrences are all part of natural science. It…

Q: Multi-drug resistant tuberculosis is becoming more common because of  The age of the hosts…

A: Mycobacterium tuberculosis is the bacteria that is responsible for causing tuberculosis (TB).…

Q: Light is needed for photosynthesis, because it

A: Plants and other living things perform a process called photosynthesis to transform light energy…

Q: Macmillan Learning Hominin is a group of species that includes modern humans and extinct human-like…

A: INTRODUCTION Primates : primates are mammal group including monkeys, apes and human.

Q: what are the downsides of homologous recombination?

A: Ans: Homologous recombination is the exchange of genetic information between the two identical…

Q: The arm is known as the ________ region; the neck is known as the ________ region. a. otic; axillary…

A: We can say that The human body is complex machinery that is anatomically divided into three…

Q: There are plant pigments on the column and use a 10:1 dilution of hexanes to acetone as your mobile…

A: In normal phase chromatography, the mobile phase is non-polar while the stationary phase is polar in…

Q: Questions A) what is the independent and dependent variable. B) what were the results of the…

A: Using three-dimensional computer animations of chimpanzees either yawning or with relaxed facial…

Q: List the four types of cells in the epidermis and their function: 1. 2. 3. 4. Which of these cells…

A: Skin is the organ that covers the body's external surface and thereby is the largest organ in the…

Q: Explain what structures you saw with fluorescence microscopy in lab, and what type of cells we used.

A: Introduction-- A fluorescence microscope is a optical microscope that uses fluorescence and…

Q: Consider the image below. This image shows plasmid DNA isolated through exactly the same method that…

A: Removing RNA is one of the crucial processes in plasmid purification, especially after the manual…

Q: Where does hematopoiesis take place?      spongy bone     compact bone     osteons     outer…

A: Hematopoiesis can be defined as a process through which formation of all types of blood cells takes…

Q: Name the molecules that cycle thriught living systems

A: Living organisms continuously interact among themselves and also with their environment in order to…

Q: Does increasing amylase production alleviate the symptoms of lactose intolerance? Why or why not?

A: Lactose sugar is present in the milk. So people with lactose intolerance cannot tolerate milk and…

Q: interpret constructively the given iris scatterplot below

A: The iris is the colored part of the human eye. Muscles in our iris control our pupil that is the…

Q: You have two DNA samples. Only one was expected to have plasmid DNA that was isolated from it. Both…

A: Since only one out of two samples has plasmid DNA. The sample with DNA of other forms can be…

Q: Separation of homologous chromosomes during Meiosis I requires: Select one: a. Removing centromere…

A: A division in which diploid cell reduces the chromosome number into half by cell division and…

Q: Why Researchers choose to use animal models in pharmaceutical research?  Explain.  Please explain at…

A: In the UK, about one-third of animal research is carried out by or funded by the pharmaceutical…

Q: Speculate why humans have evolved additional barriers to tumors compared to mice. What are some of…

A: For almost all animals, old age is associated with a common decline in tissue structure &…

Q: Clary Leonhart used the pET vector system to express her prokaryotic amylase enzyme. added peptone…

A: i) Clary failed to obtain her protein of interest in this experiment because she forgot to induce…

Q: Does the prenatal environment have an influence on a fetus's future developmen

A: Introduction Mammals include people. This was a lesson we all had in elementary school.…

Q: At the very end of cellular respiration (glycolysis followed by pyruvate oxidation, the citric acid…

A: Cellular respiration is the process by which energy is produced by the breakdown of glucose. In…

Q: Draw a strict consensus tree based on your tree and Tree 2. Circle all the polytomies.

A: The strict consensus tree is a tree where the included clades are those that are present in all the…

Q: If glycolysis has an overall –DG (i.e., it’s exergonic), why does it require an energy investment of…

A: Glycolyis can be defined as a process in which one mole of glucose is converted into two moles of…

Q: Write the basic information of different types of rats or mice( at least 7 and add their pictures).…

A: 1- House mouse (Mus musculus) Color: black or dusty gray. Weight : 0.75oz Length : 6 to 7 inches.…

Q: B cells are most important in the _______ immunity type of _______ immunity.? .A.Cellular;…

A: We know that Immunity is resistance to disease. The two important components of immunity are innate…

Q: Create a graph as a better way to display the data in the table 2) Determine which mutations (5q,…

A: Tumorigenesis or oncogenesis refers to the initial formation of cancer, where normal cells is prone…

Q: Write the cross using correct symbols. What kind of cross is this called?

A: The alleles are the alternative forms of a gene that are located on the same locus of a homologous…

Q: Species A has 2 amino acids. minimum codon length: Species B has 7 amino acids. minimum codon…

A: Introduction :- The biggest group of organisms in which any two individuals of the right sexes or…

Q: Which of the following phylogenies would be rejected as optimal by the parsimony criterion?…

A: Phylogenetic represents evolutionary relationship between taxons in the phylogeny.

Q: Besides real time PCR, Shania will also be using other variations of PCR; Multiplex PCR, Reverse…

A: Multiplex PCR used in  temperature-mediated DNA polymerase in a thermal cycler.    Multiplex PCR is…

Q: Which of the following substances is unlikely to diffuse across the lipid bilayer of a typical cell…

A: The cell membrane is also known as the plasma membrane. It is made up of two phospholipid layers.…

Q: what is the reason for an individual to have fasting high HDL levels. list and explain reasons.…

A: Introduction:- HDL ( High Density Lipoproteins) is an essential and good form of the cholestrol…

Q: A B Figure 1 The postgraduate student, Vanessa, cloned her gene of interest into two different…

A: A vector is a living organism that can transmits an infectious agent from an infected animal to…

Q: Discuss the steps you would proceed after selecting your E. coli strain to prepare competent cells…

A: c) We can select the E. coli DH5α cells to prepare competent cells for cloning. The steps for the…

Q: Which is the most important digestive enzyme in gastric juice

A: The most important digestive enzyme in gastric juice is pepsin. Gastric juice is formed in the…

Ecological adaptations

An ecological adaptation is any morphological, physiological, or behavioral trait of an organism that allows it to survive and reproduce in a habitat or ecosystem. Adaptation is a biological mechanism by which an organism gradually gets more acclimated to its surroundings.