34) What amino acid sequence is coded for by the following DNA coding strand? (Recall: the DNA template strand runs 5' to 3' and the mRNA strand runs antiparallel to the DNA template strand. Recall that DNA is translated with a start codon.) 5'-TTATGCGACCAGACCAGTTT-3' Coding strand
Q: STEM Workplace Practices Q3
A: The objective of the question is to understand the purpose of release-testing in the context of…
Q: Import of fatty acids is used for which of the following? (check all that apply) Group of answer…
A: ANSWER WELL EXPLAINED ABOVE
Q: Phospholipid lateral motion in membranes is characterized by a diffusion coefficient of about 1 x…
A: The objective of the question is to calculate the distance traveled by a phospholipid in a bilayer…
Q: Digestion of cellobiose in cows produces two glucose units which is then absorbed into the bloodand…
A: Now, let's calculate: 1: Glycolysis produces 2 ATP.2:From oxidative phosphorylation, each NADH…
Q: Your lunch meal contains rice, fish, vegetables and water for drinks. Identify the nutrients…
A:
Q: 1. Opine dehydrogenases (ODH) have evolved in invertebrate marine organisms with wide-ranging…
A: To determine the L/D configuration of amino acids, place the alpha carbon () in the center, the…
Q: 3. (a) The activity of the Pentose Phosphate Pathway is commonly quantified by measuring 14CO2…
A: To further understand the utilization of [1-14C]glucose and [6-14C]glucose in the test and the…
Q: When the amino acid sequence information and structure of a protein whose activity is unknown are…
A: Yes, inferring the activity of a protein based on its amino acid sequence and structure is a common…
Q: Import of fatty acids is used for which of the following? (check all that apply) Production of…
A: The import of fatty acids into a cell can be used for several purposes. Step 1. Production of…
Q: what is balanced chemical equation for the oxidation of benzoin to benzil using sodium hypochlorite
A: ### Reactants1. **Benzoin**: This is an organic compound with two aromatic rings bonded together…
Q: Biochemistry (Topics: Glycolysis and Citric Acid Cycle) - If glucose is labeled with 14C in C-2,…
A:
Q: 1. What is the isoelectric point of tyrosine? Draw out the different structures of tyrosine at each…
A: **Since you have posted multiple questions, we will provide the solution only to the first question…
Q: Activity 1B: Identical or Non-identical? Direction: Complete the table below by classifying the…
A: Genotypes can be classified by examining the letters within the genotype.Homozygous dominant (AA):…
Q: PLease help me fill in all the information
A: 1. Pyruvate to Alanine:Pyruvate is a three-carbon compound produced during glycolysis, which is the…
Q: A high KM will result in an efficient enzyme. A. True B. False Specificity constant = Kcat/ KM kcat…
A: The appropriate responses to your queries are as follows:A high KM will result in an efficient…
Q: Give me a question I can ask my professor about regarding this
A: If you have any questions, please let me know. I am grateful to help you :)
Q: Calculate α' for an inhibitor with KI' = 10.0 nmol L-1 when 100 nmol L-1 of inhibitor is present.
A: Step 1: Given data : Ki = 10.0 nmolL-1 I = 100 nmolL-1 Alpha=? Step 2: Formula: Alpha = 1+ [I] /…
Q: Can H₂N-(AA)₂-Cys-(AA)-Lys-(AA)-Cys-(AA)-COOH HOOCCH₂S give by simple oxidation SCH2COOH…
A: The particular reaction in question, involving the formation of SCH2COOH, appears to be chemically…
Q: For the following results of Thermodynamics of Borax Solubility, the volume of Borax solution…
A:
Q: How does a protein 'know' how to fold into its native conformation and in general why is folding…
A: Proteins are made up of amino acids, which are linked together in a specific sequence by peptide…
Q: COOM HO quercetin p-hydroxybenzoic acid A B Molecule A: 162 g/mol Molecule B: 1520 g/mol Molecule C:…
A: Size exclusion chromatography is the technique of separating of analyte molecules based in their…
Q: In the same kinetics experiment above without the inhibitor, what is the fraction of occupied enzyme…
A: Michaelis Menton equationFor a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton…
Q: All of the following are accurate contrasts for beta oxidation vs fatty acid synthesis except which…
A: In both beta-oxidation and fatty acid synthesis, the hydroxylacyl group retains the same…
Q: Draw the product AND propose a reasonable, detailed stepwise mechanism, using curved arrow notation…
A: here in first step in presence of base H+ ion is removed from alpha position of carbonyl carbon and…
Q: 2. Draw the ringed form of D-glucose with the following modifications: (a) Convert to sugar acid at…
A: Below answer given Explanation:Step 1:(A) Step 2:(B)(C)&(D) Step 3: Step 4:
Q: 2. The mature form of TEM-1 ß-lactamase, an enzyme of 290 amino acid residues that hydrolyzes…
A: Before calculating the isoelectric point (pI) of the enzyme, we need to be thorough with the…
Q: Digestion of cellobiose in cows produces two glucose units which is then absorbed into the bloodand…
A: Approach to solving the question: yield of ATP during cellular respirationOne glucose molecule used…
Q: Certain bacteria can respire in anoxic environments using arsenic (V) as electron acceptor. The…
A: “Since you have posted a question with multiple sub-parts, we will provide the solution only to the…
Q: Below you will find the structures for nurine and pyrimidine. a. Label each structure with its name…
A: a) In the images provided:The structure labeled as "Pyrimidine" represents the basic molecular…
Q: raw the reaction between sphingosine and arachidonic acid. Draw out the full structures.
A: Sphigosine is the platform molecule of sphingolipids. Arachidonic acid is a 20 carbon fatty acid…
Q: Calculate KI (in units of nmol L-1) for a competitive inhibitor that has α = 1.65 when 11.0 nmol L-1…
A: α=1+ [I]/KIWhere:α (alpha) is the degree of inhibition[I] is the concentration of the inhibitorKI…
Q: ucleotide c a. Draw a likely mechanism for the following reaction (EC 6.3.4.2) from ribonucleotide…
A: Both reactions (a) catalyzed by [EC 6.3.4.2] and (b) catalyzed by [EC 6.3.3.1] involve transfer of…
Q: A single futile cycle, i.e. one round of glycolysis plus one round of gluconeogenesis consumes: 6…
A: According to the given data you can say that 4 ATP ; 0 NADH ( 2 ATP consumed in glycolysis and 2 ATP…
Q: The 5’ cap is involved in all the following except: Question 19 options: Splicing exons…
A: The processing of mRNA formed from transcription is called post transcriptional modification. Thes…
Q: 9. Lactose exists in two anomeric forms, Draw both anomeric forms of lactose. Why no anomeric forms…
A: Answer is as follows lactose and sucrose both are the forms of sugar.Lactose form 2 anomeric…
Q: Briefly describe one of the mechanisms by which enzymes facilitate faster reaction rates in…
A: Enzymes are biological catalysts, meaning they accelerate chemical reactions without being consumed…
Q: 9. A) Please write down the names of the following protein folds. A B C B) Which one(s) is made of…
A: C) Haemoglobin the motif is coiled structure which facilitates binding of four polypeptide chains,…
Q: In bacteria, what is the role of the Shine-Dalgarno sequence? Question 3 options: It binds to…
A: The Shine-Dalgarno sequenceRibosomal binding site in mRNA.It enables initiation of protein synthesis…
Q: Take a look at the following molecule, and then answer the questions in the table below it. (You can…
A: Here's a breakdown of the chemical structure you showed me as to why it is a fatty acid:The molecule…
Q: What does the Michalis-Menten equation tell you? A. The velocity of an enzyme under physiological…
A: Approach to solving the question: Detailed explanation:The Michaelis-Menten equation provides a…
Q: Select all that applies
A: To ensure that all of the 14C label is released as 14CO2 during fermentation, the 14C label must be…
Q: 12. What is the major organic product obtained from the following reaction? OCH 3 Br2 CH3CO₂H Br 1 2…
A: This is reaction undergo electrophilic aromatic substitution. Electrophilic aromatic substitution is…
Q: 4. (4 pts) a) Describe one way in which Rubisco could be improved to optimize photosynthetic…
A: Rubisco, or Ribulose-1,5-bisphosphate carboxylase/oxygenase, is the most abundant protein in the…
Q: STEM Workplace Practices Q2
A: The objective of the question is to understand the role of stability testing in ensuring the quality…
Q: You will have to dilute your inital Lysozyme stock in order to pipet volumes larger than 10 uL for…
A: Step 1:For the Bradford assay, the typical concentration range of protein you want to target is…
Q: Given that the protein Burger is found only in the blood of patients with Sillyitis, with the aid of…
A: The Enzyme-Linked Immunosorbent Assay (ELISA) is a powerful technique used to detect and quantify…
Q: a) How does the Grotthuss mechanism and proton translocation through the membranes differ from the…
A: The chemiosmotic theory (some would argue that it is still a hypothesis and not a theory) has been…
Q: 1. a. Draw the following pentapeptide: lysine-leucine-aspartate-threonine-phenylalanine b. Label the…
A: In the drawn pentapeptide, each amino acid is represented by a letter code, and the peptide bond is…
Q: List all of the regulatory enzymes from both Glycolysis and Gluconeogenesis, and under each, list…
A: Glycolysis:Hexokinase:(-) Inhibitors: Glucose-6-phosphate (product inhibition)(+) Activators: None…
Q: Consider the synthesis of lauric acid (12:0) in a coconut tree, a C3 plant. This will require you to…
A: Coconut trees are mini lauric acid factories• 6 two-carbon building blocks (acetyl-CoA) are…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Original sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3REFLECT AND APPLY DNA synthesis always takes place from the 5' to the 3' end. The template strands have opposite directions. How does nature deal with this situation?Codon-Anticodon Recognition: Base-Pairing Possibilities (Integrates with Chapter 11.) Draw base-pair structures for (a) a G:C base pair. (b) a C:G base pair. (C) a G:U base pair, and (d) a U:G base pair. Note how these various base pairs differ in the potential hydrogen-bonding patterns they present within the major groove and minor groove of a double-helical nucleic acid.
- Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC 1. Identify the gene from which the querysequence originates (Name of gene) 2. Provide the FULLprotein sequence encoded by the gene. 3. Are different splice variants known for this gene? 4. What human disease has been connected to this gene? 5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where the protein carries no net electrical charge) of the protein.Restriction sites of Lambda (A) DNA - In base pairs (bp) The sites at which each of the 3 different enzymes will cut the same strand of lambda DNA are shown in the maps (see figure 3 B-D), each vertical line on the map is where the respective enzymes will cut. A DNA A (bp) 48502 10 000 20 000 30 000 40 000 9162 17 198 B Sal I 7059 14 885 28 338 35 603 42 900 (bp) Hae III 11 826 21 935 29 341 38 016 (bp) 11648 29,624 Eco R1 (bp) 10 592 16 246 28 915 41 864 Figure 3: Restrictrion site map showing the following A) inear DNA that is not cut as reference B) DNA CLt with Sal L C) DNA cut with Hae , D) DNA cut with Eco RI 1. Calculate the size of the resulting fragments as they will occur after digestion and write the sizes on the maps below. Note that linear DNA has a total size of 48 502 bp (see figure 3A). Page 3 of 7 9162 17 198 Sal i (bp) 7059 14 885 28 338 35 603 42 900 Hae I (bp) 11 826 21 935 29 341 38 016 11648 29,624 Eco R1 (bp) 10 592 16 246 28 915 41 864COMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGC
- Typed explanation only Codons in mRNA molecule and their corresponding amino acids UUU Phenylalanine UAU tyrosine UUA leucine UAA nonsense GCA alanine AAU asparagine AAG lysine UGC cysteine GUU valine UCG, UCU serine Refer to Table 8.2. If the sequence of amino acids encoded by a strand of DNA is serine-alanine-lysine-leucine, what is the order of bases in the sense strand of DNA? Group of answer choices 5' TGTGCTTTCTTA 3' 3' AGACGTTTCAAT 5' 3' UGUGCAAAGUUA 5' 5' AGAGCTTTGAAT 3' 3' TCTCGTTTGTTA 5'why DNA polymerase cannot remove all the RNA primers from Okazaki fragments to form a lagging strand. Explain.5'-[seq]-3' The diagram shows the results of gel electrophoresis for Sanger sequencing. The wells are represented by open boxes and the DNA bands are represented by black boxes. The wells are labeled to show which dideoxy reaction was loaded into each. Write the sequence of the original template strand used for this sequencing reaction, with the 5’ end on the left and the 3’ end on the right.
- Digestion of a DNA sample with Decll, which is a "4-cutter" enzyme that produces blunt (rather than "sticky") ends, generated numerous DNA fragments, including a 15 bp piece whose sequence is indicated below (note that only one of the DNA strands is specified). 5' TCTGAATTCCGTAGA 3' Based on this information, the recognition sequence for the Decll enzyme must be 5' 3. [specify using single letters]First Letter A G U с 22. Using the provided "Genetic Code-Reference" answer the following question. Based on the following DNA template strand, write out the amino acid chain produced. 23. Consider the following mRNA base codon sequence 5'-AUC-GAA-3' and the provided "Genetic Code-Reference". Genetic Code-Reference UUU UUC UUA UUG CUU CUC CUA CUG (mutated or silent) (mutated or silent) b. Briefly explain your reasoning for each. (be sure to include both parts) AULLY AUU a. Label which of the following would result in a mutated amino acid sequence or a silent mutation. (May help to first determine the original amino acid sequence, then compare to mutations) U Phe mRNA codon sequence: anticodon sequence: amino acid sequence: Leu Leu 5'-AUA-GAA-3' Val 5'- AUC-GAC-3' AUC Ille AUA AUAJ *AUG Met/Start GUU GUC GUA GUG UCU UCC UCA UCG) CCU) CCC ccc CCA 000 CCG ACU ACU ACC ACA ACG, C GCU GCC GCA GCG Second Letter Ser Pro Thr 3'-CAA-GTC-TGT-5' Ala UAU UAC) Tyr Туг A **UAA Stop UAG Stop CAU] CACJ…Determine the sequence of a polypeptide treated with trypsin and chimotripsine. Below are the fragments generated with each treatment. Determine the original sequence for both fragmentations (reduerde that they must be equal in the order of amino acids) Quimotripsina 1. Leu-His-Lys-Gln-Ala-Asn-Gln-Ser-Gly-Gly-Gly-Pro-Ser 1. Gln-Gln-Ala-Gln-His-Leu-Arg-Ala-Cys-Gln-Gln-Trp 2. Arg-lle-Pro-Lys-Cys-Arg-Lys-Phe Trypsin 1. Arg 2. Ala-Cys-Gln-GIn-Trp-Leu-His-Lys 3. Cys-Arg 4. Gln-Ala-Asn-Gln-Ser-Gly-Gly-Gly- Pro-Ser 5. lle-Pro-Lys 6. Light 7. Phe-Gin-Gln-Ala-Gln-His-Leu-Arg