4. A bacterium is suddenly expelled from a warm human intestine into the cold world outside (hey, it's been a cold December!). Which of the following adjustments might the bacterium make to maintain the same level of membrane fluidity? 1) Produce lipids with hydrocarbon tails that are longer and have fewer double bonds J) Produce lipids with hydrocarbon tails that are shorter and have more double bonds K) Decrease the amount of cholesterol in the membrane L) Decrease the amount of glycolipids in the membrane Answer: Explanation:
Q: have the following phenotypes: Rough and spotted: Incorrect answer: 56.25% Rough and solid:…
A:
Q: ACTIVITY 2: Protein Synthesis DNA: 3' A G C C GTA GA ATT is Using this strand of DNA as a template,…
A: The basis of inheritance is the information passed down from parent to offspring. The replication of…
Q: 126 Which products of the citric acid cycle are funneled into the electron transport chain? (give…
A: Introduction: A chain of compounds known as the "electron transport chain" uses the electrons from…
Q: Explain how Ethnic Origin (regional ancestry) can be determined from bone but not “Race”. Explain…
A: Answer : Ethnic Origin (regional ancestry) can be determined from bone but not “Race” by clearly…
Q: Why are there sexual conflicts of interest among primates between the sexes? Detail the "anisogamy…
A: When males and females pursue reproductive strategies that are incompatible with one another,…
Q: the human eye that contribute to its ability to capture images of the real world.
A: Eyes are the visual organs. The eyes of most vertebrates are placed laterally upon the head,…
Q: Explain why you chose A or B, etc. Provide a logical explanation defending your answer choice. Q1:…
A: 1 & 2) The greatest species richness refers to the number of different species that live in an…
Q: The response. B cells, humoral O T cells, humoral produce antibodies as part of the O macrophages,…
A: Introduction: Immune system component known as an antibody that circulates in the blood and lymph in…
Q: The pH Scale 1. A substance with a pH of 4 is. acidic than a substance with a pH of 6. A. 1 B. 10 C.…
A: Introduction : The measurement of hydrogen ion concentration present in the solution is known as…
Q: In a population of 643 mice, 124 had white coat colour (a recessive trait) while the rest had black…
A: Random mating occurs when individuals in a population mate with other individuals in the population…
Q: why the therapeutic effect takes weeks to manifest while side-effects occur immediately in tricylic…
A: Depression and anxiety are significant disorders that frequently need medical treatment. Anxiety is…
Q: 4. Compare and contrast ESCs and iPSCS by considering the following: B) List two ethical…
A: Stem cells: The human body is composed of multiple cell types that perform various functions. One…
Q: The etiologic fraction refers to which of the following? Group of answer choices C. Fraction of…
A: The greatest estimate of the percentage of disease incidence that would be avoided if a particular…
Q: A patient is diagnosed with lung cancer using imaging. To establish the best treatment option,…
A: Since you've asked multiple questions, we're only answering the first three for you. If you want any…
Q: (A) sten Kit fox 另一萬 Scorpion Grasshopper ECOLOGY Se Figure 21.15 Plants Golden eagle Ground…
A: Secondary consumers include scorpions. They consume insects in this food chain. They are known to…
Q: QUESTIONS 1. Using a reference, find the function of simple cuboidal epithelial tissue in humans and…
A: Simple cuboidal epithelium is a type of epithelium that consists of a single layer of cuboidal…
Q: One basic purpose of experimental design is to reduce the number of participants needed O to control…
A: Introduction Experimental design is the process of carrying out research in an objective and…
Q: What role does the environment play in addressing the needs of society?
A: The environment is a physical area where living things communicate with its non-living elements.…
Q: What kind of name that bug?
A: Being an insect it belongs to the Phylum Arthropoda. It has jointed appendages, contains exoskeleton…
Q: Can you summarize and explain for me what you want to tell in the article below? When I read it…
A: The above article describes about the Interference with Cellular Uptake, Immobilization, and…
Q: What phenotypes do you think a homozygous tra1hsn animal with a loss of function Egl-1 mutation…
A: The phenotype is the physical appearance or observable trait of an individual genotype. The…
Q: Drugs and other medecine uses the concept of signaling. Cite some drugs how they mimic natural…
A: Many drugs mimic cell signalling molecules thereby stimulating cell function and compensate for…
Q: Given the short-tandem repeats (STRS) of the child below. Which adults below could be the parents?…
A: A short tandem repeat is a microsatellite with repeat units of 2 to 7 base pairs in length, and the…
Q: Background: There are ten major phyla that represent the invertebrate animals. Though they all share…
A: The answer is not based on the lesson you have mentioned but the answer is from general knowledge.…
Q: 44. Experiments have shown increasing fertilization tends to reduce the numb resources for plant…
A: Any element in the environment that has the potential to restrict a process, such as the expansion,…
Q: week when I mutated the SSA1 gene in yeast it made cells grow faster, but made them sensitive to…
A: Hypertrophy is the increase in cell size. Single gene exerting its effect on more than one trait is…
Q: Opportunistic infections are often the proximal (most direct) cause of death in individuals with…
A: Opportunistic infections (OIs) are infections that affect persons with impaired immune systems more…
Q: There are various types of connective tissue. Explain how differences in this tissue type aid in…
A: Connective tissue is found in between other tissues and is present everywhere in the body, including…
Q: minimum edit distance
A: The minimum edit distance between two strings is defined as the minimum number. of editing…
Q: Describe the basic process of pattern formation in segmented animals. Please expain me indded with…
A: Segmented animals are those animals have repeated oragans and there body have composed of…
Q: Which species are examples of intrasexual selection? Please select all correct answers. a. Elk b.…
A: Intrasexual selection is a selection in which there is competition occurs between members of the…
Q: Can you help me? Thank you- Chloroplasts in eukaryotes are similar to cyanobacteria in that: There…
A: Chloroplast are plant organelles which contain chlorophyll and help in photosynthesis Structure of…
Q: Template strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’. 2a). Following transcription, what…
A: Introduction The process by which a gene's information is used to produce either RNA molecules that…
Q: Are cells grown in the laboratory will function similarly when transplanted?
A: Transplanting laboratory-grown cells into the body causes them to behave similarly. For instance,…
Q: Based on the haplotype network below, which statement is correct? a. None of the answers is correct…
A: A sort of genetic difference within humans can be called single nucleotide polymorphisms or SNPs.…
Q: The union of the male and female gametophyte in angiosperms and gymnosperms results in A seed,…
A: The name "angiosperm" comes from a Greek word that means "vessel." The angiosperm is essentially a…
Q: the relationship of knee height and arm span between standing height?
A: Arm span also referred as "wingspan" is described as the physical measurements of length from one…
Q: Describe 4 ways that tend to distinguish each of the following taxonomic groups: all primates from…
A: Taxonomic groups are the hierarchical categories used to classify living organisms. These groups,…
Q: Match the following events with the stages in Meiosis Prophase I…
A: These are the stages of meiosis first division which is associated with reproductive cells. The egg…
Q: our short answer should be 2-5 sentences depending on the question. (Ch. 50). Please answer both…
A: The several kinds of sensations that humans are capable of perceiving are used to guide our motor…
Q: Explain the comercial scale of the gros michel banana
A: The commercial scale of the Gros Michel banana was very large. It was one of the most popular and…
Q: I know that Enterobacter Clocoae was supposed to test positive for the catalase test. My test…
A: Enterobacter Clocoae is gram negative bacteria, it is rod shape bacteria that has flagella all over…
Q: Which of the following statements is not true about heritability? a. H^2 is always a number between…
A: Estimation of a trait's heritability is particular to one population in a particular setting, and it…
Q: Identify the parts in these plant and animal cells. Human cheek cell, 400x Outermost layer Animal…
A: Image in left upper corner: As human cheek cell is an animal cell, the organelle that contains DNA…
Q: The cell cycle checkpoint in G2 is utilized to detect ... Select an answer and submit. For keyboard…
A: The cell cycle checkpoint is a control point in the cell cycle, where cells pause and check to make…
Q: Why is it very unlikely that the Zika virus will become a permanent resident of Michigan?
A: Zika virus is mostly spread by the bite of Aedes mosquitoes such as Aedes aegypti and Aedes…
Q: In the dark, bipolar cells are O inactive due to open Cl- channels O active due to open Na+ channels…
A: Bipolar cells are neurons located in the retina of the eye. They receive input from photoreceptors,…
Q: 3'-TAC TGA GCA AGA TTA CAT ACT-5' Write down the mRNA sequence for the given DNA sense strand…
A: A mutation in both copies of the HBB gene results in sickle cell disease (SCD), a hereditary…
Q: 2. Restriction Enzyme Mapping - use any resources to assist you including the hints below. A…
A: Focus only on EcoR1. Than focus on EcoR1 and HindIII. Than focus on EcoR1, HindIII and Pst1
Q: Evolution of Prokaryote into the Eukaryote cell type. A. What are the significant the significant…
A: The major changes that are represented in the evolution of prokaryote cells into eukaryote cells…
Step by step
Solved in 2 steps
- 3. The diagram to the right depicts a cell submerged in a solution. The cell membrane is permeable to water but not to sugar. Start by completing the % concentrations of water of the intracellular and extracellular solutions. a) What is the cytosol in this example? (circle the correct term below) hypotonic hypertonic isotonic b) How do you know? 30% Sugar % Water d) Predict: What is going to happen to the size(mass) of the cell? 60% Sugar % Water c) Because the solutions are not isotonic, osmosis is going to occur. In what direction is water going to move? e) Predict: What is going to happen to the extracellular solute concentration?1. Diffusion towards the center of a bacterium Let us consider a bacterial cell that depends on chemical reactions using oxygen to produce energy. The cell needs to obtain molecular oxygen from the extra-cellular medium by diffusion through the cell membrane. We model the cell as a water-filled sphere of radius 1 µm. This means that we neglect the presence of the internal structures of the cell: nucleus, nutrients, etc. The oxygen diffusion coefficient (O2) in water at 25°C is 1.0x10-5 cm².s'. Figure 1: Transmission electron microscope Reminder: The distance travelled by diffusion can be picture of a bacterium. [from _Wikipedia: written as L(t) = \6Dt, where D is the diffusion coefficient and t the diffusion time. “Transmission Electron Microscopy"] How long would it take the O2 molecule to diffuse from the periphery towards the center of the cell ?1. Simple diffusion across membranes is faster for which type of molecules? a)Lipophilic substances b)Hydrophilic substances c)Amphipathic substances d)Polar molecules 2. One of the following is true of active transport? a)Substances diffuses following its concentration gradient b)Substances passively diffuse against its concentration gradient c)Energy is used to transport substances against its concentration gradient d)The movement of an ion down its electrochemical gradient is coupled with transport of another molecule against its concentration gradient 3. What happens to the volume of a red blood cell that is placed in a hypertonic solution. a)It shrinks b)volume does not change c)Volume increases 4. What was the effect of excessive water consumption on the osmolarity? a)It decreased b) It increased 5. A protein that is in a secondary structure has one of the following characteristics a)Amino acids of a single peptide chain are bound to each other by five different types of…
- Match the definitions with the words: Direct Diffusion, Facilitated Transport, Active Transport a) passive movement of molecules through a protein channel, down the solute's concentration gradient b) using a vesicle to move many molecules into a cell c) movement of molecules through a protein transporter, requires ATP, against the solute's concentration gradient1. Indicate which statement is incorrect. a) Channel proteins are open from both sides so that molecules can go through them. b) Channel and carrier proteins both get molecules across the membrane c) Carrier proteins usually have more control over which molecules can go through them. d) Channel and carrier proteins always use passive transport.8. Which of the following do NOT involve the movement of chemicals from a greater concentration to a lower concentration? a) simple diffusion b) osmosis c) facilitated diffusion d) filtration
- 6. A carrot, when dried out, becomes soft. There is a way to make it firm and crisp. Explain how and why, using the following guidelines. a) Draw and label a representative cell of the carrot, in its dried state. Be precise in your drawing. b)Describe the type of extracellular solution that is appropriate to add to make the desired change (name and define what type of solution, the net movements of solvent and solutes, etc.). c)Draw a representative cell of the carrot, in its possible state after the change. Represent the movement of water using an arrow to indicate what has happened.7. Label the following diagrams of Red Blood Cells and Plant Cells as being examples of cells contained in Isotonic, Hypertonic and Hypotonic solutions. H,0 H,0 H,0 H,0 H,0 H,0 H,0 H,03. You have a protein that is easily extracted from a cell membrane preparation, without any associated lipids, by washing with a buffer containing a salt (e.g. 2M NaBr) without the need to treat the membrane with detergents. What type of protein do you have? E) Peripheral (extrinsic) F) A protein covalently anchored to membrane fatty acids G) Transmembrane H) None of the above Answer: Explanation: 4. A bacterium is suddenly expelled from a warm human intestine into the cold world outside (hey, it's been a cold December!). Which of the following adjustments might the bacterium make to maintain the same level of membrane fluidity? I) Produce lipids with hydrocarbon tails that are longer and have fewer double bonds Produce lipids with hydrocarbon tails that are shorter and have more double bonds K) Decrease the amount of cholesterol in the membrane L)Decrease the amount of glycolipids in the membrane Answer: Explanation: 5. Which of the following membrane lipids does not contain fatty…
- 7) Which is the best definition of osmosis?a) movement of molecules from an area of their higher concentration to an area of their lower concentrationb) movement of water across a membrane from an area of high concentration to a lower concentration.c) movement of molecules from an area of their lower concentration to an area of their higher concentration.d) movement of water across a semipermeable membrane from an area of low concentration to a higher water concentration with the use of ATP.e) movement of water across a semipermeable membrane from an area of high concentration to a lower concentration.8) Transcriptional factors are required for transcription in all the following organisms except: a) Protozoa b) Bacteria c) Archaea d) Eukarya e) b & c.9) The composition of the flagellar apparatus is more complex in ___ as compared to Prokaryotes: a) Protozoa b) Bacteria c) Archaea d) Mycota e) a & d16. Which of the following best defines the term "exocytosis"? A) The discharge of proteins in cytoplasmic vesicles from a cell following fusion of the vesicles with the plasmalemma B) Diffusion of lipid-soluble molecules from a cell across the cell membrane C) The uptake of material at one domain of a cell's surface and its discharge from the opposite side of the cell D) The discharge of ions or small molecules from a cell by protein pumps in the membrane E) The process by which proteins move from one cytoplasmic compartment to another1. Which of the following statements is true? Mitochondria likely originated from an aerobic bacterium engulfed by a pre eukaryotic cell, the signal sequence that directs proteins into mitochondria matrix is a hydrophilic helix; proteins import into mitochondria cross the membrane in folded state; no energy is required for proteins import into mitochondria 2. Which of the following statements about vesicular transport is true? Clathrin is the only coat proteins used in vesicle formation; motor proteins are not needed for vesicular transport; the orientation of transmembrane proteins is not preserved during vesicular transport; cargo proteins do not cross membrane during vesicular transport 3. Which of the following statements regarding the nucleus is true? The nucleus is surrounded by a single layer of membrane, the nuclear envelope is not connected with the ER membrane, proteins of any size can freely diffuse through the nuclear pore complexes