6. Vampire bats are mammals that consume blood as their only source of nutrients. Because blood is rich in iron, it is necessary for the digestive system of the vampire bat to manage excess iron. Like humans, ferritin and transferrin receptor gene products are expressed by the vampire bat genome and function to maintain iron homeostasis. Ferritin A. The iron response element (IRE) binding protein is able to regulate expression of both ferritin and transferrin receptor genes. What feature of these genes allows for specific regulation by the IRE binding protein? B. How is activity of the IRE binding protein regulated? C. In an environment with excess iron, what levels of mRNA and protein do you expect to detect of Ferritin and Transferrin receptor? Briefly explain. Explanation Transferrin receptor RNA levels ( ) high ( ) low ( ) high ( ) low Protein levels () high levels ( ) low levels () high levels ( ) low levels

6. Vampire bats are mammals that consume blood as their only source of nutrients. Because blood is rich in iron, it is necessary for the digestive system of the vampire bat to manage excess iron. Like humans, ferritin and transferrin receptor gene products are expressed by the vampire bat genome and function to maintain iron homeostasis. Ferritin A. The iron response element (IRE) binding protein is able to regulate expression of both ferritin and transferrin receptor genes. What feature of these genes allows for specific regulation by the IRE binding protein? B. How is activity of the IRE binding protein regulated? C. In an environment with excess iron, what levels of mRNA and protein do you expect to detect of Ferritin and Transferrin receptor? Briefly explain. Explanation Transferrin receptor RNA levels ( ) high ( ) low ( ) high ( ) low Protein levels () high levels ( ) low levels () high levels ( ) low levels

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter37: The Endocrine System

Section: Chapter Questions

Problem 1VCQ: Figure 37.5 Heat shock proteins (HSP) are so named because they help refold misfolded proteins. In...

See similar textbooks

Similar questions

14)How does a compound that inhibits the GTPase activity of ras affect cell responses to growth factors? It would increase proliferation. It would increase glucose production. It would decrease glucose production. It would decrease proliferation.
Figure 9.10 In certain cancers, the GTPase activity of the RAS G-protein is inhibited. This means that the RAS protein can no longer hydrolyze GTP into GDP What effect would this have on downstream cellular events?
1A.If transcription factor G is downstream of EGFR and upregulates gene H, what happens to H if Grb2 has an ER signal sequence? 1B. If transcription factor A is phosphorylated by Akt and upregulates gene B, what happens to gene B if a PI3K inhibitor is added? Choices are: A. No expression of the gene B. Upregulation even in the absence of stimulation/ EGF C. Upregulation but only in the presence of cytokine/ EGF
6) The functioning of the "Ras/MAPK" signal transduction pathway is absolutely essential in order for cells to grow, divide, and migrate. One important protein that is part of this pathway is BRAF. This protein is a kind of enzyme called a "kinase" – an enzyme that transfers a phosphate group onto another protein. - In some melanomas, a mutated form of BRAF called BRAF Val600AGlu drives the progression of the cancer. The drug “vemurafenib" slows the progression of the cancer by slowing the production of the mutant BRAF protein. (National Cancer Institute. 2019. Types of Cancer Treatment. Retrieved from: https://www.cancer.gov/about-cancer/treatment/types/ Is this an example of a traditional cancer therapy or a targeted therapy? Briefly explain your reasoning in the space provided, using information provided in the text to support your answer. Type of therapy (traditional or targeted)?: Brief explanation: 19
1. The following image shows a mechanism in which gene expression activity is regulated by ligand. Arg RS-2 Teu Met RBS Ligand RBS hidden a. What is this kind of regulatory machnism called? b. Does it involve transcription or translation? c. What happens in the presence of the ligand? d. What happens in the absence of theligand? e. What do you think the genes that are regulated here - metabolic (breakdown) or anabolic (buildup) for the ligand? Explain
5) Briefly explain why the formation of a tumour can pose a risk to a person's homeostasis. 6) The functioning of the "Ras/MAPK" signal transduction pathway is absolutely essential in order for cells to grow, divide, and migrate. One important protein that is part of this pathway is BRAF. This protein is a kind of enzyme called a "kinase" – an enzyme that transfers a phosphate group onto another protein. In some melanomas, a mutated form of BRAF called BRAF Val600AGlu drives the progression of the cancer. The drug "vemurafenib" slows the progression of the cancer by slowing the production of the mutant BRAF protein. (National Cancer Institute. 2019. Types of Cancer Treatment. Retrieved from: https://www.cancer.gov/about-cancer/treatment/types/ Is this an example of a traditional cancer therapy or a targeted therapy? Briefly explain your reasoning in the space provided, using information provided in the text to support your answer. Type of therapy (traditional or targeted)?: Brief…
5. Explain the signaling steps that take place after the EGF receptor is dimerized, up to the poiunt when Ras gets activated. Draw a schematic to make it easier for your classmates to understand.6. Explain why the RTK signaling pathway includes the extra complication of having a protein (Ras) that switches between GTP- and GDP-bound states. PLEASE ANDWER BOTH
1. Insulin is a protein that allows sugar (glucose) to enter the body's cells (mainly liver, adipose tissue and skeletal muscle). This hormone plays a key role in the regulation of glucose levels in the blood ('hypoglycemic' effect). It is produced by the beta cells in the pancreas.A piece of the gene sequence that encodes for insulin contains: 5’ ATG-GCC-CTG-TGG-ATG-CGC-CTC-CTG-CCC-CTG-CTG-GCG-CTG-CTG-GCC-CTC-TGG-GGA-CCT-GAC- CCA-GCC-GCA-GCC-TTT-GTG-AAC-CAA-CAC-CTG-TGC-GGC-TCA-CAC-CTG-GTG-GAA-GCT-CTC-TAC-CTA-GTG-TGC-GGG-GAA-CGA-GGC-TTC-TTC-TAC-ACA-CCC-AAG-ACC-CGC-CGG-GAG-GCA-GAG-GAC-CTG-CAG-GTG-GGG-CAG-GTG-GAG-CTG-GGC-GGG-GGC-CCT-GGT-GCA-GGC-AGC-CTG-CAG-CCC-TTG-GCC-CTG-GAG-GGG-TCC-CTG-CAG-AAG-CGT-GGC-ATT-GTG-GAA-CAA-TGC-TGT-ACC-AGC-ATC-TGC-TCC-CTC-TAC-CAG-CTG-GAG-AAC-TAC-TGC-AAC-TAG 3’ d. Mutation of codon 34 (CAC to GAC) and 85 (CGT to CAT) of the insulin gene causes hyperinsulinemia which may contribute to diabetes. Identify the amino acid replacement from these mutations. e.…
1. Insulin is a protein that allows sugar (glucose) to enter the body's cells (mainly liver, adipose tissue and skeletal muscle). This hormone plays a key role in the regulation of glucose levels in the blood ('hypoglycemic' effect). It is produced by the beta cells in the pancreas.A piece of the gene sequence that encodes for insulin contains: 5’ ATG-GCC-CTG-TGG-ATG-CGC-CTC-CTG-CCC-CTG-CTG-GCG-CTG-CTG-GCC-CTC-TGG-GGA-CCT-GAC- CCA-GCC-GCA-GCC-TTT-GTG-AAC-CAA-CAC-CTG-TGC-GGC-TCA-CAC-CTG-GTG-GAA-GCT-CTC-TAC-CTA-GTG-TGC-GGG-GAA-CGA-GGC-TTC-TTC-TAC-ACA-CCC-AAG-ACC-CGC-CGG-GAG-GCA-GAG-GAC-CTG-CAG-GTG-GGG-CAG-GTG-GAG-CTG-GGC-GGG-GGC-CCT-GGT-GCA-GGC-AGC-CTG-CAG-CCC-TTG-GCC-CTG-GAG-GGG-TCC-CTG-CAG-AAG-CGT-GGC-ATT-GTG-GAA-CAA-TGC-TGT-ACC-AGC-ATC-TGC-TCC-CTC-TAC-CAG-CTG-GAG-AAC-TAC-TGC-AAC-TAG 3’ a. Mutation of codon 34 (CAC to GAC) and 89 (CGT to CAT) of the insulin gene causes hyperinsulinemia which may contribute to diabetes. Identify the amino acid replacement from these mutations. 2.…
4e. You also study the expression of 3 different mutants for this gene. For each mutant answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? 1 20 ORI 40 60 5..ТТCGAGCTСТСGТCGTCGAGATACGCGATGATATTACTGGTААТАТGGGGATGCАСТАТС..3' 3'...AAGCTCGAGAGCAGCAGCTCTАTGCGСТАСТАТААТGACCATTATAССССТАСGTGATAG..5' * promoter i. Mutant A has a single base pair substitution with the T/A being replaced with C/G base pair at position 35 (position denoted by the * in the sequence above). ii. Mutant B has a 2 G/C pairs inserted between position 19 and 20 (position denoted by the ^ in the sequence above).
3) The sex of some reptiles, including the American alligator, is determined by the temperature at which the eggs are incubated. For example, incubating them at 33°C produces mostly males, while incubation at 30°C produces mostly females.Scientists recently discovered a thermosensor protein, TRPV4, that is associated with this process in American alligators. TRPV4 is activated by temperatures near the mid-30s, and increases the movement of calcium ions into certain cells involved with sex determination. The results of this scientific investigation will most likely lead other scientists to hypothesize that * human sex cells also contain the TRPV4 protein 0) the TRPV4 protein affects the growth of plants other reptiles may have the TRPV4 protein in their eggs the TRPV4 protein is present in all of the foods eaten by alligators
Proteins found in the blood respond to blood vessel damage by clumping together forming a clot that physically blocks the hole in the vessel and prevents further blood loss. If clotting proteins were active all the time, they would create clots throughout your circulatory system. Which of the following would be the most efficient way for the body to regulate the expression of the proteins involved in clotting? A. Tightly package the genes for clotting proteins so that RNA polymerase cannot access them unless they are needed. B. Produce and store the clotting protein in an inactive form. When the protein is needed, use another protein to activate the clotting protein. C. Constantly make the clotting proteins, but then break them down instantly after translation if they are not needed. D. Use a repressor protein to keep clotting genes turned off until they are needed.