A CODING STRAND of DNA has the sequence 5' ATGCCG 3' what would the resultant mRNA transcript produced from this section of the DNA be? Group of answer choices 3' AUGCCG 5' 5' AUGGCC 3' 3' UACGGC 5' 5' UACGGC 3' 5' TACGGC 3' 5' AUGCCG 3'
Q: Which mRNA strand is complementary to this template DNA strand: 5’-CTGCAT-3’? 3’-AUGCAG-5’…
A: Template strand is the strand of DNA molecule on which the mRNA is synthesized. Complementary strand…
Q: . The table opposite shows the standard (coding strand) DNA rinlet codes for the 20 amino acids…
A: Introduction :- The process of protein synthesis occurs in two steps which are transcription and…
Q: Answer for 1 ,2,and 3 asap
A: Answer given in steps 2 onwards. Please find the attachment. Thank you
Q: Below is a double-stranded DNA: ATATGTGGTCTCGGTCCGTTAGGCAAT TATACACCAGAGCCAGGCAATCCGTTA 1. In…
A: The first step in gene expression is the synthesis of an RNA molecule copied from the segment of DNA…
Q: 5'AGGCTCCAGG 3' Which complementary RNA strand can be made from this sequence? Select one: O a. 5'…
A: formation of m RNA from DNA is called transcription. RNA polymerase synthesizes m RNA by adding…
Q: You are provided with a sample of aardvark DNA. As part of your investigation of this DNA, you…
A: DNA stands for De-oxyribonucleic Acid. DNA is polymer of nucleotides. Nucleotides are molecules…
Q: You come across four polynucleotide strands. The first is an original RNA strand that codes for a…
A: A mutation occurs when the sequence of DNA changes. Mutations can occur as a result of DNA copying…
Q: The following is a section of DNA removed from a cell nucleus: 5'…
A: The basic physical and functional unit of heredity is the gene. DNA is the material that makes up…
Q: If the sequence of one strand is 3’ ATTAGCA 5’, then the sequence of the opposite strand would be…
A: Complementary base pairing is a process in which each nucleotide base can hydrogen-bond with a…
Q: What should be the complementary strand of 3'-ATGGCTTGA-5'? Select one: a. 5'-TACCGAACT-3' b.…
A: DNA or deoxyribonucleic acid is a double stranded polynucleotide that is present within the nucleus,…
Q: The following DNA strand is the CODING strand. What is the sequence of the RNA which is transcribed…
A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: Below is the 5'-3' strand of a double-stranded DNA molecule with the following nucleotide sequences…
A: According to Bartleby guidelines only the first question in case of multiple questions have to be…
Q: 1. DNA coding strand: CCC TCA ATC GAG AAA GGT DNA template strand: MRNA: Peptide chain: 2. DNA…
A: The DNA is the genetic material in living organisms that is composed of specific nucleotide…
Q: The strand of DNA contains the sequence of bases: CGA CCG TAC. What is the sequence of the…
A:
Q: Translate this DNA sequence using Genetic Code 5' - ATG GGG cCC GTC CAT CCG TAC GCC GGA ATT ATA - 3'…
A: DNA is transcribed into mRNA through the process of transcription. mRNA is then translated into…
Q: ATCGGCTAGCTACGGCTATTTACGGCATAT The above string of nucleotides represent a DNA leading strand of…
A: DNA is a double helical structure composed of two DNA strands.
Q: For each DNA segment: [1] What is the sequence of the mRNA molecule synthesized from each DNA…
A: Gene expression is the process by which the instructions in the DNA is converted into a functional…
Q: 1. Transcription: Write out the sequence of mRNA that would result from transcription of the…
A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…
Q: 1. Determine what amino acid will be formed from the given DNA strand below:…
A: DNA strands are coiled with each other and form the DNA double helix. Each strand of DNA contains…
Q: The coding DNA strand of a gene has the following DNA sequence: 5' ATGGCGACGATAATGTTGTGTGAGTGA 3' 1)…
A: At first you have to know about coding and non-coding strand. A coding atrand is a DNA strand that…
Q: What will be the sequence of mRNA produced by the following stretch of DNA? 3' ATCGGTTAAC 5'…
A: Transcription is the process of synthesis of an RNA molecule from the DNA template strand. Where RNA…
Q: Determine what amino acid will be formed from the given DNA strand below:…
A: Introduction: DNA stands for 'deoxyribonucleic acid' and it is the hereditary material in humans and…
Q: The following is a strand of DNA. Please write out the correct mRNA that ll DNA strand and make sure…
A: Messenger RNA is a single-stranded RNA molecule that is complementary to one of the DNA strands of a…
Q: Answer the following whether it is TRUE or FALSE: 1. For each DNA segment 3'-ACCTGCCTACCCG-5' the…
A: In molecular biology the central dogma states the transcription and translation process in order to…
Q: Hello, my question is in the picture below. Thank you in advance!
A: Transcription is the process of converting DNA into m-RNA in the presence of enzyme RNA polymerase.…
Q: For a double stranded coding region DNA transcribed from left to right and whose top strand is…
A: There are two strands of DNA. One strand goes from 5' to 3' and the other strand goes from 3' to 5'.…
Q: 4. A double-stranded DNA molecule with the sequence shown below produces, in vivo, a polypeptide…
A: Transcription is the DNA dependent RNA synthesis. Process of transcription is catalyzed by RNA…
Q: The coding DNA strand of a gene has the following DNA sequence: 5’ ATGGCGACGATAATGTTGTGTGAGTGA 3’…
A: Answer: Central Dogma : It is the complete procedure of replication , transcription and translation…
Q: If one DNA strand has the nucleotide sequence below, what is the nucleotide sequence on its…
A: DNA and RNA are the two types of nucleic acids. Deoxyribose nucleic acid (DNA) is present in all…
Q: What are the correct codons of the MRNA from the given DNA strand th needs to be transcribed? *…
A: Sense strand It is also called as the coding strand , plus strand or the non template strand. The…
Q: 3. DNA: TACGGGCCTATACGCTACTACT CA TG GATCGG MRNA: UC Codon: Anitcodon: Amino Acids: 4. DNA: G T…
A: Since we are entitled to answer first question, we’ll answer the question 3 as you have not…
Q: DUE IN 30 MINUTES. This is multiple choice. No need for explanation, answer only. Thank you! A…
A: Basic amino groups (-NH2) and carboxyl groups (-COOH) are found in amino acids. Proteins have amino…
Q: The following sequence of DNA is part of the normal, wild-type gene. 5'TAC CGG GAC TTG AGC CGA…
A: A single nucleotide from the DNA is deleted in nucleotide deletion. Although the single nucleotide…
Q: Which of the following statements about RNA is/are incorrect? I. RNA strand synthesis does not occur…
A: Genetic material may consist of a single gene, a segment or set of genes, or the complete genome. It…
Q: Which of the following is/are true? 1. Oils are different from fats because they are plant derived…
A: Oils are different from fats because they are plant derived and mostly contain unsaturaded fatty…
Q: A DNA antisense strand contains the following nucleotide base sequence: ACG TTT ATG GGT From this,…
A: DNA has two strands. One of the strands acts as the template strand for the synthesis of mRNA, while…
Q: What mRNA base sequences are complementary to the following DNA template sequences? Be sure to label…
A: The process by which the mRNA is transcribed from the parental DNA is known as the process of…
Q: A. Consider the following DNA sequence (coding strand) located near the middle of the coding region…
A: Answer option ll will result in shorter strand
Q: The following is the base sequence of DNA that codes for amino acids 506-510 of the protein that…
A: Since we only answer up to 3 sub-parts, we’ll answer the first 3. Please resubmit the question and…
Q: When given the DNA message sequence, 5'-ACT-3', what would be the corresponding DNA template strand…
A: In biology, a DNA strand is the double-stranded molecule of nucleic acid that serves as the…
Q: DNA strand below: 3’ T A C A T G C C G A A T G C C 5’ Discuss how will replication happen by…
A: Introduction: DNA stands for 'deoxyribonucleic acid' and it is the hereditary material in humans and…
Q: Like DNA, RNA follows base-pairing rules. Experiment to find which RNA nucleotide on the right side…
A: Adenine bonded with thymine
Q: One strand of DNA has the base sequence as shown below. Complete the transcription and translation…
A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: 5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' Write the sequence of the DNA…
A: The central dogma of life involves three processes. They are: Replication: In this process, copies…
Q: The following is a part of the sequence on DNA template strand. 5' ATGGCCCGGTAAGTA 3' Write the…
A: A codon is a sequence of three consecutive nucleotides in a DNA or RNA that codes for a specific…
Q: You obtained a sample of double-stranded DNA and transcribe mRNA from this DNA. You then analyse the…
A: Introduction Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains that coil…
Q: 3. The enzyme responsible for transcribing complementary DNA from mRNA is DNA Polymerase…
A: 3. the process of transcribing complementary DNA from RNA is called as reverse transcription. this…
Q: A DNA antisense strand contains the following nucleotide base sequence: CGA TTT GGT TGA From this,…
A: INTRODUCTION The RNA polymerase enzyme will read the DNA strand and make the mRNA molecule.
Q: 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Make vertical…
A: Codons are made of three nucleotides of DNA or RNA. Each codon codes for an amino acid. The amino…
Q: A portion of one strand of DNA has the sequence 5′ ATTCGGTAA 3′. If this strand is used as a…
A: Since you have asked multiple question, we will solve the first question for you. If you want any…
A CODING STRAND of DNA has the sequence 5' ATGCCG 3' what would the resultant mRNA transcript produced from this section of the DNA be?
3' AUGCCG 5'
5' AUGGCC 3'
3' UACGGC 5'
5' UACGGC 3'
5' TACGGC 3'
5' AUGCCG 3'
Trending now
This is a popular solution!
Step by step
Solved in 4 steps
- Answer the following whether it is TRUE or FALSE: 1. For each DNA segment 3'-ACCTGCCTACCCG-5' the sequence of the mRNA molecule synthesized is 5'-TGGACGGATGGGC-3' 2. In the template strand TACCGAGGTATGTAC, the coding strand is 5'-ATGGCTCCATACATG-3'. 3. In the template strand TACCGAGGTATGTAC, the coding strand is 5'-AUGGCUCCAUACAUG-3'. 4. The template strand is the strand of DNA used for RNA synthesis. 5. Transcription forms a messenger RNA molecule with a sequence that is identical to the DNA template from which it is prepared.What are the correct codons of the MRNA from the given DNA strand that needs to be transcribed? * Sense strand 5' AAT GCC AGT GGT3' Antisense strand MRNA 000 000 TRNA (anticodon) Figure 1. Amino acid (peptide) 3' TTA CGG TCA CCA 5' 5' TTA CGG TCA CCA 3' 3' UUA CGG UCA CCA 5' 3' AAU GCC AGU GGU 5'Answer the following: DNA fragment A is 3' AGC CCG CTC CGA GGC TAA AAG CGT 5' 1. is % of guanine in DNA fragment A 2. is the 4th codon in the complement of DNA fragment A from the 5' end 3. is the 3rd codon in the mRNA copied from DNA fragment A from the 3' end 4. is the N-terminal amino acid of the peptide produced 5. is the C-terminal amino acid of the peptide produced
- The sequence of part of an mRNA transcript is What is the sequence of the DNA coding strand? 5'- 5' - AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG - 3' 5'- ATGGGGAACAGCAAGAGTGGGGCCCTGTCCAAGGAG What is the sequence of the DNA template strand? TACCCCTTGTCGTTCTCACCCCGGGACAGGTTCCTC Incorrect -3' -3'3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Make vertical lines between codons to make this assignment easier to do. Which strand is the template strand? The first strand is the template strand as it going 3-5 Copy the template strand in mRNA. Label the 5’ and 3’ ends. 5' AUG UUA CCC GCU GCG CGA AGC AAA GUC UAA 3” Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins. Met-Leu-Pro-Ala-Ala-Arg-Ser-Lys-Val What do you notice about the mRNA strand compared to the non template strand of DNA? 2. What amino acid does the second codon code for on the DNA template strand? ______Assume the 6th amino acid in the strand is changed from a T to a C. What amino acid does it code for now? _______ What type of mutation is this? 3. Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would…The partial sequence of a gene Question 2 coding strand is: 5'-TACGATCATAT-3. This sequence is transcribed. What is the sequence of the corresponding RNA? A 5'-UACGAUCAUAU-3’ B 5'-ATATGATCGTA -3’ C 5'-AUGCUAGUAUA-3’ D 5'-AUAUGAUCGUA-5’ E 5'-TATACTAGCAT-3’
- The DNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using this sequence, write the sequence of the polypeptide that results from this gene. Be sure to appropriately label the ends of the molecule. 5'-ATGCACGGCGACTAG-3' Second letter A UAU Tyr UAC First letter U A G U UUU1 UUC UUA LOU Leu CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu AUU AUC lle AUA AUG Met Val C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala CAU His CAC CAA CAG Gin AAU Asn AAC AAA 1 Lys AAG LYS G {}a UAA Stop UGA Stop A UAG Stop UGG Trp GAU 1 GAC Asp GAA GIU Glu GAGJ UGU UGC CGU CGC CGA CGG AGU AGC AGA AGG Cys GGU GGC GGA GGG Arg Ser Arg DOA DOA DOA DUTO Third letter GlyWhat would the amino acid sequence be for the following DNA Transcript? 5’AAGCCATTTAAAGGC 3’ 3’ TTCGGTAAATTTCCG 5’ Phe Gly Lys Phe Pro Phe Leu Lys Phe Val Lys Phe Phe Lys Pro Lys Pro Phe Lys Gly More information is neededHere is the nucleotide sequence of an imaginary strand of DNA: 5’ AATTGGCCATGC 3’. If this strand of DNA was transcribed, the resulting messenger mRNA molecule would be: Met-Val-Tyr-Lys 3’ TACGTACG 5’ 3’ TTAACCGGTACG 5’ 3’ UUAACCGGUACG 5’
- Below is a double stranded DNA that contains an ORF. Identify the ORF and in the spaces below, first provide the mRNA sequence that would result (in the 5' to 3' direction). Then give the protein sequence this mRNA would encode (in the N to C direction using the 3-letter abreviations and a single space in between). 5'-CTGCGC TAGGCGCAGTAGGGCATCCCACGACA-3' 3'-GACGCGATCCGCGTCATCCCG TAGGG TGC TGT-5' Codon Table: บบบ UUC JUA UUG CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu Leu AUU AUC lle AUA AUG Met Val mRNA sequence: UCU UCC UCA UCG protein sequence: CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala UAU UAC UAA UAG CAU CAC CAA CAG Tyr Stop GAU GAC His Gin AAU Asn AAC AAAG} LUS Asp GAA GAG} Glu UGU Cys UGC UGA Stop UGG Trp CGU CGC CGA CGG AGU AGC Arg Ser AGG} Arg GGU GGC GGA GGG (DO NOT include the 5' and 3' numbers or the N and C. Write only the nucleotides and the abreviations for the amino acids. Include no spaces in the mRNA and a single space in between the amino acid…What will be the sequence of mRNA produced by the following stretch of DNA? 3' ATCGGTTAAC 5' TEMPLATE STRAND 5' TAGCCAATTG 3' CODING STRAND 1. 5' AUCGGUUAAC 3' 2. 3' GUUAAGGCAU 5' 3. 3' GUUAACCGAU 5’ 4. 5' UAGCCUUAAC 3'Which of the following represents the sequence of an RNA transcript for which the coding strand (also known as non-template strand) of DNA has the sequence: GTACTGGCTAGCTGCTAGAA? Note all sequences are written 5'-3'. OA. AAGAUCGUCGAUCGGUCAUG OB. AAGATCGTCGATCGG TCATG OC. GTACTGGC TAGCTGC TAGAA OD. GUACUGGCUAGCUGCUAGAA