What will be the sequence of mRNA produced by the following stretch of DNA? 3' ATCGGTTAAC 5' TEMPLATE STRAND 5' TAGCCAATTG 3' CODING STRAND 1. 5' AUCGGUUAAC 3' 2. 3' GUUAAGGCAU 5' 3. 3' GUUAACCGAU 5’ 4. 5' UAGCCUUAAC 3'
Q: Derive the amino acid sequence that is coded for by each of the following mRNA sequence. 5' CAA…
A: Amino acid are molecules which are combine to form a protein molecules.Amino acid are synthesized by…
Q: Refer to the DNA sequence provided: 3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ a. What is the…
A: In this question, we are given anticoding sequence of DNA. This is also called as antisense strand…
Q: 1.) if the B chain of human hemoglobin is 146 amino acids in length, calculate the minimum # of…
A: The fundamental task of delivering oxygen from the lungs to bodily tissues is performed by red blood…
Q: If a polypeptide chain is 30 amino acids, how many nucleotides will make up the coding mRNA strand?…
A: Amino acids are the monomers that join together by peptide bond formed between the carboxyl end of…
Q: 5'AGGCTCCAGG 3' Which complementary RNA strand can be made from this sequence? Select one: O a. 5'…
A: formation of m RNA from DNA is called transcription. RNA polymerase synthesizes m RNA by adding…
Q: How many bp in length is the fully processed MRNA if it contains a 50 bp poly A tail. Draw the fully…
A: DNA and RNA differ in only one of the four nitrogenous bases. RNA has uracil instead of thymine. DNA…
Q: Consider the following portion of mRNA produced by the normal order of DNA nucleotides: 5’ – CUU AAA…
A: Transcription is process through which DNA is converted into mRNA.
Q: TACTGCCTCCCCATAAGAATT
A: Transcription is the process in which a gene's DNA sequence is copied (transcribed) to make an RNA…
Q: the gene above is transcribed into a functional mRNA, a.) how many codons will be carried by the…
A: The process of formation of messenger RNA with the help of template strand of DNA is called…
Q: 1. What would be the amino acid sequence encoded by the mRNA 5' C C A U G A C G U C G G A U C A A U…
A: Only proline amino acid form as second codon is stop codon here
Q: 1. Determine what is being meant by each statements: a. It describes mRNA that results in a single…
A:
Q: A CODING STRAND of DNA has the sequence 5' ATGCCG 3' what would the resultant mRNA transcript…
A: Coding strand is the strand which contain the sequence that are identical to the mRNA transcript…
Q: Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' 1. Where N stands for any nucleotide, give…
A: *Given DNA sequence is 3'-TACTTNGTNCTNTCN - 5' 1* Here N will be any nucleotide so take Him place…
Q: The DNA sequence of a short gene from a sea slug, and the mature RNA synthesized from this gene, are…
A: The transcription is the process in which the mRNA copied information from DNA for protein…
Q: The coding sequences of Gene F and Gene G are shown by the double-stranded DNA below: Gene F 5'…
A: According to the question, we have to write down the messenger RNA sequence ad the polypeptide chain…
Q: Shown below is the sequence of the 5' end of a hypothetical mRNA. Where does translation of this…
A: Translation occurs when the mRNA gets attached to the ribosome and subunits and the initiation…
Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…
A: According to guidelines we have to answer the first 3 sub-parts only. so please kingly post the…
Q: After sequencing a segment of DNA you identify the following sequence: 5…
A: Answer: DNA sequence : It is the genetic sequence or the order of nucleic acids in DNA. DNA…
Q: 7. A segment of a DNA strand consists of ...GCTTAGACCTGA.... (a) Identify the expected nucleotide…
A: DNA to mRNA is transcription and mRNA to protein is translation.
Q: If a DNA sequence is 5’ CGCTAGACT 3’, the complementary DNA sequence will be? If a DNA sequence is…
A: DNA (deoxyribonucleic acid) was discovered by Friedrich Miescher. Nucleotides are the structural…
Q: The following DNA sequence is part of one exon and contains the beginning of a gene’s open reading…
A:
Q: 5’GCTATAAAGCGTATCGCGTCATA 3
A: Complementary mRNA 5’GCT ATA AAG CGT ATC GCG TCA TA '3 3'CGA UAU UUC GCA UAG CGC AGU AU '5
Q: 5. What is the correct reading frame for the following mRNA? MRNA 5' GGCACUUAUGCGAUGCCUUGAGUGACCAU…
A: mRNA is made from DNA by the process of Transcription.
Q: Assume the first nucleotide in the sequence is at the +1 position. Transcribe the DNA sequence into…
A: Deoxyribonucleic acid is the genetic material found within a cell's nucleus. Before cell division,…
Q: Given the template DNA sequence: 3’ - TAC - CAG - GTT - ACC - ATC - 5’ A.) What will be the…
A: Note : Hi ! Thank you for the question. We are authorized to answer three subparts at a time. Since…
Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…
A: According to guidelines we have to answer the first 3 sub-parts only. so please kingly post the…
Q: Which is the DNA template given if the MRNA is 3- CGGAUGCCCGUAUAC -5 ? O 3- GCCTACGGGCATATG-5 O 5-…
A: The common rule of Base pairing in DNA is: A pairs with T by a double bond and G pairs with C by a…
Q: You are given the following mRNA sequence. You know that it contains some UTR sequence and the…
A: Proteins are defined as polymers of amino acids. As there are 22 standard alpha-amino acids by which…
Q: Transcribe an mRNA sequence from this TEMPLATE STRAND of DNA 3' CGTACGTGTATCCCATCC 5' 5'…
A: Translation is the process in which ribosomes in the cytoplasm or endoplasmic reticulum synthesize…
Q: Assume the first nucleotide in the sequence is at the +1 position. Transcribe the DNA sequence into…
A: ANSWER;-
Q: Using the mRNA codon table below and your knowledge of transcription and translation, complete this…
A: Biological macromolecules are those large molecules that are necessary for the survival and growth…
Q: Write down the complementary mRNA sequence for each of the following DNA sequence. A:…
A: If template sequence of the DNA is A.. mRNA is .. AUGGAUCGCGUGUACAUCCACCCGUUUCAA
Q: What proportion (in %) of the CFTR gene/DNA sequence is represented in the CFTR mRNA? The mRNA…
A: The cystic fibrosis transmembrane conductance regulator (CFTR ) gene displays a tightly regulated…
Q: Transcribe the following DNA sequence. Then translate the resulting mRNA transcript.…
A: Mutation is any change in the DNA sequence. It can alter the protein sequence because the proteins…
Q: 3. DNA: TACGGGCCTATACGCTACTACT CA TG GATCGG MRNA: UC Codon: Anitcodon: Amino Acids: 4. DNA: G T…
A: Since we are entitled to answer first question, we’ll answer the question 3 as you have not…
Q: Your labmate gives you a gene with the following sequence of the coding strand for the first 5 amino…
A: given DNA strand first form the complimentary starnd by changing A - T and G-C for the strand 3' to…
Q: ) Assuming that transcription starts with the first C in the template strand, and continues to the…
A: Transcription Transcription is the process in which the template strand of DNA is copied into mRNA…
Q: Which of the following is/are true? 1. Oils are different from fats because they are plant derived…
A: Oils are different from fats because they are plant derived and mostly contain unsaturaded fatty…
Q: The coding sequences of Gene F' and Gene G' are shown by the double-stranded DNA shown below: Gene F…
A: The process in which the DNA is transcriped into m RNA is called transcription and the mRna is…
Q: The template strand of a gene has the sequence 5'-ATGCCTAGCCTAGGACT-3', What will the sequence of…
A: Here, the question is asking about mRNA transcript whose synthesis takes place in 5'-3' direction…
Q: Which of these single strand RNA sequences could form a hairpin secondary structure? 5'…
A: The RNA is usually a single stranded molecule of nucleic acid. In RNA four types of nitrogenous…
Q: Identify where the base pair change occurs (what letters changed?) 2.) For BOTH sequences, write…
A:
Q: 1. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand:…
A: Transcription is the process of synthesis of mRNA by using a template DNA strand. Translation is the…
Q: What is the complementary DNA sequence to the following DNA sequence? ATGCCATCG…
A: DNA is genetic material which is involved in transfer of information into the protein. It involves…
Q: 1. what will be the mRNA complimentary strand of a DNA sequence AATCGGCTGGGATTA? a. UUAGCCGACCCUAAU…
A: DNA replication is a proces by which molecule of DNA is duplicated. DNA replication is necessary to…
Q: Below is the 5'-3' strand of a double-stranded DNA molecule with the following nucleotide sequences:…
A: Here i discuss about the coding strand, antisense strand of DNA, their transcribed products as well…
Q: A particular triplet of bases in the template strand of DNA is 5' AGT 3'. The corresponding codon…
A: ANSWER;- 3'UCA 5' Explain;- Transcription is a process of a particular DNA sequence being copied…
Q: B. One strand of a section of DNA isolated from E. coli reads: (Assume no start codon is required as…
A: Deoxyribonucleic acid (DNA) is a macromolecule made of two strands that are complementary to each…
Q: Which of the following mRNA codons signals the start of translation in eukaryotic cells? 5’-UGA-3’…
A: There are 3 stop codons: UAG(Amber) UAA(ochre) UGA(umber) These codons signal the termination of…
Trending now
This is a popular solution!
Step by step
Solved in 4 steps
- The sequence of part of an mRNA transcript is What is the sequence of the DNA coding strand? 5'- 5' - AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG - 3' 5'- ATGGGGAACAGCAAGAGTGGGGCCCTGTCCAAGGAG What is the sequence of the DNA template strand? TACCCCTTGTCGTTCTCACCCCGGGACAGGTTCCTC Incorrect -3' -3'Answer the following whether it is TRUE or FALSE: 1. For each DNA segment 3'-ACCTGCCTACCCG-5' the sequence of the mRNA molecule synthesized is 5'-TGGACGGATGGGC-3' 2. In the template strand TACCGAGGTATGTAC, the coding strand is 5'-ATGGCTCCATACATG-3'. 3. In the template strand TACCGAGGTATGTAC, the coding strand is 5'-AUGGCUCCAUACAUG-3'. 4. The template strand is the strand of DNA used for RNA synthesis. 5. Transcription forms a messenger RNA molecule with a sequence that is identical to the DNA template from which it is prepared.Which of these single strand RNA sequences could form a hairpin secondary structure? 5' AAAAAAAAAAAAAAAAAAA 3' 5' ACACACACACACACACAC 3' 5' CCCGGGGUUUUCCCCGGG 3' 5' UUUUUUUUUCCCCCCCCC 3' 5’ UUUGGGUUUGGGUUUGGG 3’
- What is the sequence of the mRNA transcript that will be produced from the following sequence of DNA? The top strand is the template strand, the bottom strand is the coding strand. 5’ – TCGGGATTAGACGCACGTTGGCATACCTCG – 3’ 3’ – AGCCCTAATCTGCGTGCAACCGTATGGAGC – 5’ Enter the mRNA sequence here (pay close attention to the direction of the molecule!): 5'-_____-3'Transcribe an mRNA sequence from this TEMPLATE STRAND of DNA 3' CGTACGTGTATCCCATCC 5' 5' GCAUGCACAUAGGGUAGG 3' 5' GCAUGCACAUAGGGUAGG 3' 3' CGUACGUGUAUCCCAUCC 5' 5' GCATGCACATAGGGTAGG 3' 3' CGTACGUGTATCCCATCC 5'The DNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using this sequence, write the sequence of the polypeptide that results from this gene. Be sure to appropriately label the ends of the molecule. 5'-ATGCACGGCGACTAG-3' Second letter A UAU Tyr UAC First letter U A G U UUU1 UUC UUA LOU Leu CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu AUU AUC lle AUA AUG Met Val C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala CAU His CAC CAA CAG Gin AAU Asn AAC AAA 1 Lys AAG LYS G {}a UAA Stop UGA Stop A UAG Stop UGG Trp GAU 1 GAC Asp GAA GIU Glu GAGJ UGU UGC CGU CGC CGA CGG AGU AGC AGA AGG Cys GGU GGC GGA GGG Arg Ser Arg DOA DOA DOA DUTO Third letter Gly
- Given the following DNA sequence of the template strand for a given gene: 5' TTTCCGTCTCAGGGCTGAAAATGTTTGCTCATCGAACGC3' Part A ) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends). Part B ) Use the genetic code to write the peptide sequence translated in a cell from the mRNA in part A. Please use the 3 letter abbreviation for each amino acid. Part C: How would the peptide synthesized in a cell be different if the mRNA was translated in vitro (i.e. not in the cell)?Consider the following DNA template: 5’-AAGAGGTTCCAATGCAGGCACTCACCAACTCTTAAATAAA-3’ 3’-TTCTCCAAGGTTACGTCCGTGAGTGGTTGAGAATTTATTT-5’ If the bottom DNA strand is used as template to transcribe mRNA, predict the amino acid sequence that would result from the process of translation. Met-Ala-Leu-Thr-Gln-Glu-Gly Met-Gly-Ser-Leu-Asn-Ser-Gln Met-Thr-Asn-Ser-Leu-Ala-Gln Met-Gln-Ala-Leu-Thr-Asn-Ser Met-Glu-Ala-His-Trp-Ser-TyrGive the RNA molecule sequence transcribed from the following DNA sequence of a eukaryotic gene and with the correct 5' and 3' ends. DNA: 5'-ATAGGGCATGT-3' 3'-TATCCCGTACA-5' <--- template strand Group of answer choices 5'-ATAGGGCATGT-3' 3'-UAUCCCGUACA-5' 5'-AUAGGGCAUGU-3' 3'-TATCCCGTACA-5'
- What is the DNA template for the RNA sequence 5' UAACGGAGCCUAAUC 3'? O 5' GAUUAGGCUCCGUUA 3' O 5' AUUGCCUCGGAUUAG 3' 5' GATTAGGCTCCGTTA 3' 5' TAACGGAGCCTAATC 3' O 5'ATTGCCTCGGATTAG 3'5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence.If the sequence of a coding strand of a gene is 5' ATGGCAT 3', the sequence of the MRNA would be: 5’AUGGCAU 3' ОЗ ТАССGTA 5' 3' UACGGUA 5' 5' ATGGCAT 3' O 5' UACGGUA 3'