A D. J B с

Q: Question 10 of 11 A pentapeptide has the abbreviation "GREAT". Draw the peptide and give its…

A: Peptides are small sequences of amino acids. The individual amino acids in a peptide are joined…

Q: The octapeptide gly-cys-met-asn-lys-ala-tyr-gly was hydrolyzed consecutively by CNBr and then…

A: The octapeptide gly-cys-met-asn-lys-ala-tyr-gly was hydrolyzed consecutively by CNBr and then…

Q: For the enzymes involved in producing ATP at an extremely high rate, please indicate the products…

A: ATP (adenosine triphosphate) is the energy currency that the cell uses in metabolic transactions.…

Q: The    figure    below    shows    a    polynucleotide: a)    Label    the    5'    and    the    3'…

A: Polynucleotide are polymer of nucleotides which are formed by the condensation of nucleotide.  The…

Q: Consider a uniport system where a carrier protein transports an uncharged substance A across a cell…

A: ∆G = R T ln (Ainside /Aoutside)  Where G is free energy change for the transport of uncharged…

Q: What should we do to prevent ourselves from toxic exposure?

A: Many chemical / biochemical species and radiations can have adverse effects on human beings . Some…

Q: Which carbohydrate test can you use to distinguish a monosaccharide from a disaccharide? hexoses…

A: A carbohydrate is a biomolecule which consists of carbon, hydrogen and oxygen atoms. The hydrogen…

Q: In affinity chromatography, which of the following strategies is used to elute a GST-POI fusion…

A: GST-POI stands for Glutathione-S-Transferase tagged Protein Of Interest. Glutathione is the…

Q: a)   Draw    the    A-T    and    G-C    base    pairs.                 - Label    the    bases…

A: DNA are polymers of nucleotides. A nucleotide consists of a nitrogenous base(A, T, G, C) attached to…

Q: Suppose that the pH of distilled water is 6.2, what will be its resulting color using phenol red.

A: The pH of a solution refers to the H+ ion concentration in the solution. A solution with a pH lower…

Q: The starting substrate and active site of a Type I topoisomerase is shown below. During this…

A: Topoisomerases change the topology of DNA by breaking either one or two of the DNA strands and allow…

Q: 6) Proteins can be modified by phosphorylation, which adds a phosphate group to the hydroxyl group…

A: Protein modification - Major types of proteins modifications are phosphorylation, acetylation and…

Q: Concerning the citric acid cycle (TCA cycle), which of the following statements is false? The TCA…

A: Cellular respiration is a collection of three metabolic pathways that generate ATP by the oxidation…

Q: Compare and contrast the principle behind DNA migration in agarose gel electrophoresis from that of…

A: Electrophoresis is a technique that involves the migration of charged molecules under the influence…

Q: of the gluconeogenesis wing is not true? A. Phosphofructokinase-1 (PFK-1) and…

A: Glycolysis - is a process in which one mole of glucose is partially oxidized into two moles of…

Q: (a) (b) (c) Draw the structure of the final DNA product for this reaction. Draw a square around the…

A: Nucleases are enzymes that degrade polynucleotides. Depending on the substrate they cleave, they can…

Q: In the alpha-helices, which of the following statement is NOT true?   a.   Backbone carbonyl…

A: Proteins are composed of amino acids that are attached together via peptide bonds. The linear chain…

Q: Please answer fast What types of interactions likely promote the dimerization of a protein?

A: Proteins are polymers of amino acids that are joined together through peptide bonds. A peptide is a…

Q: Chemistry When the steady-state concentration of a drug on one side of the membrane is 5 micromolar…

A: According to Fick's first law, dC/dt= K(C1-C2)/h

Q: 15. A substrate binds to enzyme active site. a) List the roles of serine, histidine and aspartic…

A: The enzyme has serine, histidine and aspartate in the active site.  Serine proteases are protein…

Q: Given the following reaction and equation for the initial velocity of the reaction: k₁ k3 E+SES E +…

A: We are given two equations for initial velocity (V). V=kcat [ES]    -------(eq1)       andV=k3 [ES]…

Q: Discuss how to determine the elements of proteins and its reactions.

A: Proteins are the most abundant biomacromolecule of life. Proteins are primarily polypeptide…

Q: b) It's said that secondary structures form because of intra- and intermolecular hydrogen bonding…

A: A protein's function depends on its structure. There are four levels of protein structure: primary,…

Q: NH₂ Methyltransferases NH₂ OH OH S-Adenosylmethionine (SAM) Transamination B Phosphate transfer…

A: Methyl metabolism is well conserved across bacteria to humans. S-Adenosyl methionine (SAM) is…

Q: AMP is an activator of fructose 1,6-bisphosphatase (FBPase-1) True False

A: Glycolysis is the process by which one molecule of 6 carbon glucose is broken down into 2 molecules…

Q: Biochemical events in the synthesis of ATP: I. Subunits of ATP synthase chages in conformation and…

A: ATP synthase is a complex enzyme consists of an F0 and F1 components. It uses the proton motive…

Q: Discuss the role of carbohydrates on cancer and suggest an appropriate treatment

A: Carbohydrates are biomolecules, which are the primary source of energy for the body. All of the…

Q: In the peptide, SWEETLY, bond via its side chain. (Give the full name of the amino acids) can still…

A: Recall that: for a given peptide amino acid sequences are written with N-terminal amino acid on the…

Q: 1. What happens to the pyruvate made during glycolysis under anaerobic conditions? Is this a redox…

A: Glycolysis is the breakdown of one molecule of glucose (6C) into two molecules of pyruvate (2 x 3C)…

Q: draw all the structures of the tribasic amino acid lysine involved in the equilibrium reactions that…

A: The proteins are composed of 20 naturally occurring amino acids. The amino acids can be classified…

Q: In the table below, name each functional group in anserine that is ionizable and record an estimated…

A: Serine is an amino acid with molecular formula C3H7NO3. Its molecular weight is 105.09 g/mol. Serine…

Q: 1. Why do proteins become polycations at extremely low pH and become polyanions at very high pH? 2.…

A: Proteins are biological macromolecules formed by monomers of amino acids. The amino acids have side…

Q: How is aquaporin synthesised? List step by step. How is this protein made and targeted to its final…

A: Aquaporins (AQP) are protein channels that function in the transfer of water at very high rates…

Q: The figure shows an example of a thermal denaturation plot. The melting temperature (Tm) is the…

A: The proteins re folded into their proper three dimensional structure and this folding is driven by…

Q: H3C CH3 -(HC- H₂ H₂ -C-C -CH2)3- Pristanic acid CH3 IL.

A: Pristanic acid is a branched chain fatty acid . It is 2,6,10,14 tetra methyl Penta decanoic acid.…

Q: Based on what you know about what powers ATP synthesis and how NADH and FADH2 interact with various…

A: Introduction Cellular respiration is a process by which glucose molecule breaks and produce carbon…

Q: The side chain of cysteine contains: OA) a hydroxyl group OB) an amine group C) a carboxyl group OD)…

A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…

Q: Does glycolysis take place in the presence or absence of oxygen?

A: Glycolysis is a metabolic pathway which occurs inside the cell in which glucose is breaken down for…

Q: A peptide has the following amino acid composition: 2 Met, 2 Phe, 2 Glu, 1 Arg, 1 Lys, 1 Val, 1 Leu,…

A: Recall that: Amino acid sequences are written with N-terminal amino acid on the left and C-terminal…

Q: f you have 960 nucleotides, how many codons do you have?

A: Introduction DNA is a genetic material of our body. DNA is a self replicating molecule. The…

Q: What is expected theoretical number of copies of DNA molecules after 28 cycles in a PCR experiment?

A: INTRODUCTION: DNA : Its fullform is Deoxyribo nucleic acid and It has a double stranded helix…

Q: A dialysis tube that contains 10 mL of a 5% sucrose solution and that is permeable to water but not…

A: It is the movement of water from higher water concentration to lower water concentration through a…

Q: ATP stock (50 µM): Make pre-dilutions with 20, 15, 10, 5, 2,5 and 1,25 µM ATP (1000 μL of each)…

A: Molarity is a way of representing the concentration of a solution. Molarity is the number of moles…

Q: Determine the interactions shown in the figure at point P * M N R.. CH₂ O Hydrophobic interaction O…

A: the interactions shown in the figure at point P   a)Electrostatic interaction b)Covalent bonding…

Q: -Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the…

A: Note: Hi! Thank you for the question. We are authorized to answer three subparts at a time. Since…

Q: Describe how a protein’s structure determines its function. What determines a protein’s structure?

A: Proteins have four levels of conformations known as primary, secondary, tertiary, and quaternary. In…

Q: The side chain of asparagine contains: OA) a hydroxyl group OB) an amine group OC) a carboxyl group…

A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…

Q: 31. Margarine is made from vegetable oil by a chemical process. Do you suppose this process converts…

A: Margarine is a product derived from vegetable oil, obtained by the hydrogenation,…

Q: discuss the biochemistry behind disorders related to aromatic amino acids with the aid of an…

A: Metabolic disorders are caused due to abnormalities in one or more processes in a metabolic pathway.…

Q: What is the physical or structural difference between heterochromatin (also called "heterochromatic…

A: The term "chromatin" describes the DNA and protein combination that makes up the chromosomes present…