Q: Derive the amino acid sequence that is coded for by the following mRNA sequence. 5' CAU AAA ACG GUG…
A: During the translation, the information present in the mRNA sequence results in the formation of…
Q: A) Draw the mRNA to be translated if the pre-mRNA is constitutively spliced. [ 3) Draw an mRNA to be…
A:
Q: During MRNA splicing... intron-exon boundaries are marked by exon junction complexes. the 5' cap and…
A: mRNA splicing is a process in which a newly-made precursor mRNA transcript gets converted into a…
Q: If the DNA gene reads AAT GGT CCA CCG CTG, what will the MRNA read? O A. TTA CCA GGT GGC GAC O B.…
A: DNA is a macromolecule and is composed of nucleotides having sugar , phosphate and nitrogenous bases…
Q: The second MRNA molecute is the acias they code Ior. same as the original mRNA except it has an…
A: Mutation It is defined as the alteration in the sequence of DNA due to the exposure to some mutagens…
Q: A particular DNA coding segment is ACGTTAGCCCCAGCT. Write the sequence of nucleotides in the…
A: Disclaimer: " It is assumed that the given coding strand is from 5' to 3' direction. The central…
Q: If a strand of mRNA is UGC CAU GCC, what is the sequence of amino acids that will be produced? (use…
A: Proteins or polypeptides are the end products of the gene expression process. They are polymers made…
Q: What is the amino acid sequence coded by this mRNA? MET SER ARG ASP VAL THR VAL LEU VAL SER O GLN…
A: A codon table can be used to convert a genetic code into an amino acid sequence. Because messenger…
Q: A single nucleotide addition and a single nucleotide deletion approximately 15 bases apart in the…
A: Gene is the structural and functional unit in the DNA. Genes are composed of nucleotide nitrogenous…
Q: Also answer Location number where correspond the 3 end of mRNA from this gene ans where u would find…
A: Exons are nucleic acid coding sequences that can be found in mRNA. Non-coding segments in DNA are…
Q: AMRNA strand has 87 nitrogenous bases. How many amino acids would this mRNA strand code for? 29 D 56…
A: CENTRAL DOGMA- Replication is the process when DNA replicates itself means it will make copies of…
Q: Termination of translation occurs when: a charged tRNA gets stuck in the E site release factor…
A: Question - Termination of translation occurs when: a charged tRNA gets stuck in the E site…
Q: Which of the following is true at the time introns are spliced our nRNA? O Only the 3' end of MRNA…
A: Introns are defined as noncoding sections of an RNA transcript, or it can be the DNA encoding it.…
Q: An mRNA which has a structure of 5' GCGCGAUCUGCCGCUUCGCUACUA 3' Give the corresponding ntein seque…
A: A single-stranded RNA molecule usually gets to referred as the term messenger RNA (mRNA) is…
Q: CTA GCC CTC CGT TAC TAG TTA CCT ACT TAT TCA ATT TTG TAA ACG CTC ATC CGA ACC CGC TTT TAA TTG CCC ACT…
A: Your answer given in step 2
Q: Following is an mRNA sequence reported in data base. 5’ ACC AGA ATG ACC ATG GCA 3 This is an mRNA…
A: mRNA stands for messenger RNA and it corresponds to the genetic sequence of a gene which is read by…
Q: Predict the sequence of amino acid coded by the mrna sequence 5’ GGA-GGC-ACA-UGG- GAA 3’
A: mRNA is read in 5' to 3' direction. Codons are triplet i.e. a combination of three bases codes for…
Q: Considering the given sequence of nucleotides in an mRNA molecule, (a) what is the sequence of the…
A: Gene expression is the process by which the instructions in the DNA are converted to functional…
Q: The portion of the mRNA transcript that gets removed duringRNA processing is thea. exons.b.…
A: Ans: RNA processing: The post transcription processing in eukaryotes is referred to as RNA…
Q: List 4 proteins involved in either Capping or tailing mRNA and tell whata each one does.
A: Answer: TRANSCRIPTION = It is the process of transcribing DNA in to mRNA , it is the second step of…
Q: In bacteria, since the mRNA does not require any processing to become active, and also since…
A: The cells are the primary unit of life. An organism may be unicellular or multicellular. The…
Q: Which of the following is/are typically removed from pre-mRNA during nuclear processing in…
A: The various steps that are generally observed during processing of pre-mRNA are- Addition of a 5'…
Q: The sequence of bases in a sample of MRNA was found to be: GGU,AAU,CCU,UU0,GUU,ACU,CAU,UGU a Deduce…
A: mRNA is messenger RNA which is produced as a result of transcription from DNA. RNA polymerase…
Q: Consider the wobble rules listed in Table 15.2. An MRNA has the stop codon 5' UAA 3'. What TRNA…
A: Codon is a triplet of nucleotide base pairs.
Q: A prokaryotic gene was transcribed then trans antibiotics X was added, and the products of t steps…
A: Antibiotic are the key substances which act on the major pathways of replication, transcription or…
Q: during sicing,introns of pre-mRNAs go through an intermediate stage when they are shapedlike: a…
A: RNA is the intermediate molecule in the central dogma . They carry forward the information stored in…
Q: Which two sequences shown in the diagram are NOT directly transcribed from the template strand of…
A: ANSWER - in this figure the following sequences are not directly transcribed from the template…
Q: The RNA-induced silencing complex (RISC) I. binds to and unwinds ds siRNA/MIRNA to produce ss…
A:
Q: The base sequence of the gene coding for a short polypeptide is 5’CTACGCTAGGCGATTGATCATC’3. a) What…
A: According to the central dogma, the information flows From DNA to proteins. DNA is transcribes into…
Q: Translate the mRNA sequence of HBs mRNA 5'- AUG GUG CAC CUG ACU CCU GUG GAG AAG UCU GCC GUU ACU…
A: Translation Process by which the mRNA codes for a particular protein is known as translation.
Q: What will be the anticodon of the next tRNA added to the A site of the ribosome?
A: Codons are situated in on mRNA and anticodons are situated on tRNA.
Q: Translation of mRNA is terminated at the stop codon by: A. binding of the Release Factor to stop…
A: The translation is the process, in which the new growing polypeptide chain is synthesized.
Q: RNaseP O processes the 5' end of tRNAS contains an RNA component O both a and b O none of the above
A: A ribonuclease is an enzyme that cleaves ribonucleic acid (RNA). RNA is a single stranded structure…
Q: A eukaryotic mRNA has a mutation that creates a premature STOP signal. Which of the following is…
A: Replication: It is a process of synthesis of a new DNA strand from the previously existing one.…
Q: Which of the following events has nothing to do with the mechanism known as "RNA interference"? Q a…
A: RNA interference means the silencing of the genes or gene expression is suppressed. RNA interference…
Q: During the initiation stage of translation in bacteria, which of the following events occur(s)? a.…
A: The mRNA (messenger ribonucleic acid) contains the genetic information for the protein synthesis. A…
Q: double-stranded helix
A: After mRNA synthesis there are post transcriptional processes which converts the heterogenous…
Q: How many amino acids are coded for by the following mRNA: 5…
A: From the DNA, genetic information is transcribed in the form of codons. These codons reside in the…
Q: Identify the different regions of the mature mRNA by matching terms with regions. A В AUG UGA сар…
A: Mature mRNA or mature transcript is the RNA present in eukaryotes which consists of exons with all…
Q: CTA GCC CTC CGT TAC TAG TTA CCT ACT TAT TCA ATT TTG TAA ACG CTC ATC CGA ACC CGC TTT TAA TTG CCC ACT…
A: mRNA molecule-- GAU CGG GAG GCA AUG AUC AAU GGA UGA AUA AGU UAA AAC AUU UGC GAG UAG GCU UGG GCG AAA…
Q: The first MRNA codon to specify an amino acid is always Phe Leu (F) (L) Glu Asp (E) (D) Ser (S) Tyr…
A: A gene is a DNA-based functional heredity unit that delivers instructions for the production of RNA…
Q: What protein sequence would a cell make from the following mRNA? 5'- CCAUGCACCAAUAGAUAACCG-3' O PCTN…
A: During the translation, the sequence of nucleotides in the mRNA is translated into a sequence of…
Q: The S-D (shine-Dalgarno) sequence is part of O a. 23S RNA in 50s subunit O b. 6S rRNA in 50S subunit…
A: Introduction In Bacterial And Archaeal Messenger RNA, The Shine–Dalgarno (SD) Sequence Is A Ribosome…
Q: The DNA sequence of a gene is CCATGCT A. The corresponding mRNA produced from 6. this gene is a.…
A: The protein synthesis consumes large amount of a cell’s energy as compared to the other organic…
Q: A polyA tail makes the mRNA makes degrade more quickly.
A: The poly-A tail is a long chain of adenine nucleotides that is added to a messenger RNA (mRNA)…
Q: This type of mutation, where one nucleotide was replaced for another, is called a point mutation.…
A: DNA and RNA are are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…
Q: Following the 5-> 3' conversion of writing nucleotide sequence, indicate which of the following MRNA…
A:
Q: CTA GCC CTC CGT TAC TAG TTA CCT ACT TAT TCA ATT TTG TAA ACG CTC ATC CGA ACC CGC TTT TAA TTG CCC ACT…
A: The process of synthesizing mRNA strand with the help of template stand of DNA is called…
Step by step
Solved in 3 steps
- I was wondering if it is possible to provide an explanation on the structure of the PDB code 2V1X, the amino acid at position 219 and the mutation of the amino acid name LU. Thank you.Suppose the codon sequence GUGCAAUUCGAGGCC has a single base pair mutation to GUGCAAUUCAAGGCC. If the old protein sequence was Val-Gln-Phe-Glu-Ala, what will be the new sequence encoded by the mutant gene? ____________________________.Question 1: tRNA and amino acyl tRNA synthetases Part g: What chemical and structural characters are shared by the amino acids Ile, Val and Met? Part h: What enzyme attaches Ile to tRNA? Part i: Compare the frequency of the correct Ile entering the active site and the frequency of an incorrect amino acid entering the active site of this enzyme. Be specific with numbers. Part j: Compare the frequency of the correct tRNA(Ile) entering the active site and the frequency of an incorrect tRNA entering the active site of this enzyme. Be specific with numbers. Part k: Apply the Entropy change formula and multiply by T = 303 K (30 C) to determine the energetic cost of accurately attaching Ile to its cognate tRNA(Ile). Part l: Is there enough energy in the chemical transformation of ATP → AMP + 2Pi to pay this information cost?
- (a) Answer all sections (i)- (Iv). Below is given the structure of three anti-HIV drugs: OH Meo. OMe NH Ph Nevirapine Atazanavir Staudivine (i) Give the drug target and discuss the anti-HIV mechanism of each of these drugs. Vaccines are an attractive prophylactic treatment against both viral and bacterial diseases. A number of glycaconjugate vaccines using bacterial polysaccharide structures conjugated to protein carriers have been introduced into mass vaccination schemes with excellent results. What differences are there in the immune response to a glycoconjugate vaccine as compared to a polysaccharide vaccine? These glycoconjugate va nes has been used for 30 years without any change in their structures, while the composition of the flu vaccine, based on attenuated or killed virus particies, is changed from year to year. Discuss the reason behind this. (iv) Discuss why it has not been possible to develop a (part structure) vaccine against the HIV virus, based on either I) viral…Second letter A UUU UCU) UC UCA UCG UAU UUC Phe UUA Tyr UGU UGCJ Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUG Leu CAUHIS CUU CUC CUA CUG CCU* C ССА CCG CGU His САС Leu CGC Arg CGA Pro CAA Gin CGGJ Gln Which amino acid is carried by the TRNA with the anticodon 5'-UCA-3? ACU ACC ACA AAU AAC. AGU AGC AGA AUU Ser Asn AUC Ile A AUA Thr AAA Lys AAG Lys AGG Arg AUG Met ACG GAU GGU] GUU GUC GUA GUGJ GCU GCC GCA GCG GAC Asp Ala GAA GGC Gly GGA Val GAG Glu GGGJ Isoleucine. None-this is a stop codon. Aspartic acid. Histidine. IV. Leucine O V. Third letter UCAG UCAG UCAG First letterYou are analyzing the peptide ala-ile-glu-lys-phe-val- tyr-cys. If you treat the peptide with chymotrypsin, which technique would be best to separate the fragments? O a. ultracentrifugation O b. affinity chromatography O c. dialysis d. gel filtration chromatography O e. ion exchange chromatography What is an advantage of NMR spectroscopy over x-ray crystallography in studying protein structure?
- i need definition for Posttranslational modifications for collagenA solution of peptide of unknown sequence was divided into 2 samples. One sample was treated with trypsin and the other one with pepsin. The fragments produced are given below: TRYPSIN A. Pro-Gly-Met-Phe-Leu-Arg B. Gln-Ile-Pro-Lys C. Ala-Gly-Trp-Lys PEPSIN A. Phe-Leu-Arg-Ala-Gly В. Pro-Gly-Met С. Тrр-Lys-Gln-Пе-Pro-Lys Deduce the original polypeptide chain.what does the Hexa protein domain depict? (in relation with tay sachs disease)
- Draw the peptide at a pH @1 of Cys-His-Glu-Met-Ile-Ser-Thr-Arg-TyrQuestion 28 Introns Protein-coding sequences that need to be excised B Non-coding regions that need to be excised Protein-coding sequences that form part of the mature MRNA Non-coding regions that form part of the mature MRNA Question 29 Anomers are A Either the open chain structure or the cyclic structure, established through mutarotation B) Either L or D Cyclic monosaccharides that differ only in the positions of substituents at carbon (alpha or beta) The fifteen other stereoisomers of glucose Question 30 The nuclear lamina A is the site of ribosomal RNA (FRNA) synthesis maintains the shape of the nucleus encloses the nucleus to separate it from the cytoplasm D) regulates the entry and exit of molecules from the nucleusThe following amino acids that are often found inside globulin molecules are () A, Tyr B, Phe C, Asn D, Glu True of false 1. In the de novo synthesis of purine nucleotides and pyrimidine nucleotides, base rings are first synthesized and then corresponding nucleotides are formed with phosphoribose. () 2. Transcription is the process of transferring genetic information from DNA to RNA. DNA is synthesized under the catalysis of RNA polymerase, and the direction of synthesis is from the 5 'end to the 3' end. () 3. The change of protein conformation is caused by the breaking of covalent bonds within the molecule. () 4. In very high and very low pH solutions, amino acids exist mainly in non-ionic form. () 5. The active center of an enzyme usually consists of several amino acid residues adjacent to each other in the primary structure. ()