Based on image of protein (enzyme), need to know: a) Number of amino acids and length (Angstroms) of helix denoted as H2. b) Name the post-translational modification (PTM) the enzyme has underwent. c) Name chemical reagent to undo this PTM and number of equivalents of reagent needed.
Q: Suggest and briefly describe an experimental design on testing the effect of enzyme trypsin on the…
A: Trypsin is an enzyme that is responsible for the breakdown or digestion of a protein. It is a serine…
Q: Branching decreases the solubility of glycogen. True False b. The branching enzyme forms the…
A:
Q: Please state if the statements are true or false. 1. An l-sugar is a sugar where the -OH group at…
A: Sugars are also called carbohydrates. Carbohydrates are composed of carbon, hydrogen, and oxygen in…
Q: KM is determined by measuring the reaction velocity of two enzymes (X and Y) at different…
A: Enzymes are usually protein molecules which catalyzes a biochemical reaction by decreasing its…
Q: Please state if the statements are true or false. 1. An l-sugar is a sugar where the -OH in the…
A: Sugar is also called a carbohydrate. Carbohydrates are composed of carbon, hydrogen, and oxygen in…
Q: 1. How are organic molecules related to all living things?Explain. 2. Draw an Illustration showing…
A: One or more cells make up every living thing. Living things react to their surroundings and stimuli.…
Q: An enzyme catalyzes a reaction with a Km of 7.50 mM and a Vmax of 4.15 mMs. Calculate the reaction…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: Which of the following is NOT a regulatory mechanism for catabolism and anabolism? Phosphorylation…
A: Metabolism is a series of interconnected chemical reactions occurring within a cell. Metabolic…
Q: At which pH would the structure shown be predominate? H₂N-CH- - H OpH 1 pH 3 pH 8 pH 11 0 0
A: Glycine has the simplest structure among all the amino acids. This side chain of amino acid has most…
Q: How does placing the solution in a boiling bath terminate the hydrolysis reaction mediated by…
A: The protein enzyme α-amylase is a key player in the hydrolysis reaction of starch molecules.
Q: Regulation of fatty acid metabolism is shown by the following strategies. Which statement is NOT…
A: Fatty acids are important component of the body, they serve as energy reserves of the body and help…
Q: a. Water is not a very good electron donor and requires solar energy to transfer electrons. True…
A: Photosynthesis is the conversion of light energy by phototrophs into chemical energy, which is then…
Q: Please state if the statements are true or false. 1. Erythrulose is a ketopentose 2. The conversion…
A: Erythrulose is a ketose Sugar with keto Functional group. It is mainly used in skin care products.…
Q: What TYPE of inhibition is observed in the following plot: 1/v₂ Intersect at Y axis 1/Km Competitive…
A: Enzymes can be inhibited , when the substrate and inhibitor compete for the binding to the same…
Q: Which of the following statements is TRUE about fatty acid activation before ß-oxidation? O The…
A: β-oxidation is the process of breakdown of fatty acids, in order to release energy during the…
Q: Match the lipoprotein or reaction based on the lipid transport pathway shown: DIETARY FAT AND…
A: Matching of the lipoprotein or reaction based on lipoprotein transport pathway as follows:
Q: The successful sequencing of the human genome The human genome holds an extraordinary amount of…
A: The Human Genome project or HGP is a huge project which was aimed to map and sequence the entire…
Q: Describe how enzymes are regulated (activated and inhibited)
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: Label the x axis in each graph below with the appropriate factor (possible factors: temperature, pH,…
A: Introduction: Enzymes are proteins that function as biological catalysts to accelerate the rate of…
Q: Which of the following statement(s) is/are TRUE about oleic acid? I. It has a lower melting point…
A: The double bond at C-9 exhibits Z (cis) stereochemistry, making oleic acid an octadec-9-enoic acid.…
Q: Discuss briefly but concisely the importance of the following metabolic pathway. E. Glycogenolysis…
A: These are the different pathways for carbohydrate metabolism. Glycogenolysis is the pathway for…
Q: Consider the complete oxidation of one mole of simple TAG containing lignoceric acid residues…
A: During the digestion of a triglyceride the fatty acids that are released are broken down in a series…
Q: Identify (1) the group where the lipid belongs, and (2) determine whether the lipid is saponifiable…
A: Lipids are the biomolecules that are nonpolar in nature. These can be simple lipids i.e. derived…
Q: D arrangement of localized regions of proteins A. PRIMARY B. SECONDARY
A: The three-dimensional arrangements of atoms in an amino acid chain, that folded up into specific…
Q: was diagnosed with osteoporosis («porous bones»). Osteoporosis is a common cause of fractures of the…
A: Osteoporosis causes bones to become brittle and weak, to the point where a fall or even little…
Q: What pharmaceuticals or chemical that can be derived from corn husks?
A: Introduction: Corn Husks are the outside green leaves on a cob of corn, that we usually peel off and…
Q: Consider the complete oxidation of one mole of simple TAG containing behenic acid residues (22:0).…
A: Fatty acids are oxidized through beta-oxidation followed by the TCA cycle. Beta-oxidation occurs in…
Q: If I want to make a 100mL buffer that has 2% SDS, 100mM tris pH 8, 10mM EDTA, and proteinase K…
A: Introduction: Buffer is defined as a solution that resists change in pH on the addition of acid or…
Q: Please state if the statements are true or false. 1. Xylose is a pentose and a ketose 2. Louis…
A: Xylose is a sugar. Sugar molecules are also known as carbohydrates. Carbohydrates are composed of…
Q: Eukaryotes modify mRNA with an m7G cap: an N7-methylated guanosine linked via a 5′ to 5′…
A: Post transcriptional modification in Eukaryotic mRNA occurs by its enzymatic caping. The capping of…
Q: toxicity of cyanide (CN-) results from its binding to the iron atoms of the cytochrome aa3 (complex…
A: The toxicity of cyanide (CN-) results from its binding to the iron atoms of the cytochrome aa3…
Q: NH3 eo
A: The lipid molecules are amphipathic molecules which means they have polar and non-polar functional…
Q: Compare primary, secondary, tertiary and quaternary structures of protein
A: Proteins are composed of carbon, nitrogen, hydrogen, oxygen, and sulfur atoms. Proteins are…
Q: Explain how these macromolecules break down in the body for energy. Include
A: Metabolism of macromolecules involve catabolic and anabolic reaction. Catabolism refers to breakdown…
Q: The activated form of glucose is added to the non-reducing end of glycogen molecules. True False
A: Glycogen is a branching polymer of glucose that works as energy storage in times of nutritional…
Q: 7. cis 20:5(45,8,11,14,17) 20:5;5,8,11,14,17 w3,6,9,12,15 8. trans 20:5(45,8,11,14,17)…
A: Cis and trans Fatty differ in the arrangement of hydrogen atoms on the double bonded Carbon atom.…
Q: The macromolecules that serve in the storage and transmission of genetic information are __________.…
A: Biomolecules are the organic compounds produced by living organisms. They are primarily made up of…
Q: Describe the fluid-mosaic model of the cell membrane and how it results in a semi-permeable membrane…
A: The principle function of the membrane is to separate the contents of the cell from the exterior.…
Q: Which of the following is MOST soluble in polar solvents? A H3C LOH В с D В OD Oc О А H3C. HO л HC…
A: In the given image, structures A, B, and C represents fatty acids. A is a saturated fatty acid.…
Q: why is energy released when IMFs form in between molecules as they approach eachther
A: In molecular terms, intermolecular forces are the forces of attraction and repulsion between…
Q: It's a three part question based on the chart provided asking: a) Which of these enzymes has the…
A: For an enzyme catalyzed reaction, Km is the substrate concentration that is required to attain half…
Q: Amino acid Ala Asp Arg Cys a-carboxyl group a-amino group pK a pK a 2.35 9.78 1.99 9.90 1.82 8.99…
A: There is a characteristic pH of any amino acid at which their net electric charge becomes zero, it…
Q: Why do you think you need to add NaCl?
A: Hi! Thank you for the question. We are authorized to answer three subparts at a time, since you have…
Q: 26. Which of the following amino acids can enter directly into the citric acid cycle intermediates?…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: in every Acetyl CoA entering ETC, how many ATPs are produced?
A: Glycolysis as well as the TCA cycle both are processes involved in cellular cellular metabolism. In…
Q: Is the following statement true or false?: Saturated fats have higher melting point than unsaturated…
A: Fatty acids are the simplest form of lipids/ They are long-chain hydrocarbons with one carboxyl…
Q: Identify (1) the group where the lipid belongs, and (2) determine whether the lipid is saponifiable…
A: Lipids are amphipathic molecules which means they have both polar and polar groups present in their…
Q: Match the test in column B that will best differentiate the lipids in column A.…
A: The biological macromolecules that are found in living organisms are carbohydrates, proteins,…
Q: he amino acid alanine, shown below, contains all of the following functional groups except A. an…
A: Amino acids are the building blocks of proteins which are composed of amino group (NH3+), carboxyl…
Q: You obtain the following results for the transport of an amino acid into bacteria. Based on this…
A: The cell membrane presents a hydrophobic barrier that separate the interior of the cell from the…
Based on image of protein (enzyme), need to know:
a) Number of amino acids and length (Angstroms) of helix denoted as H2.
b) Name the post-translational modification (PTM) the enzyme has underwent.
c) Name chemical reagent to undo this PTM and number of equivalents of reagent needed.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- The following is a portion of a protein: met-trp-tyr-arg-gly-pro-thr-Various mutant forms of this protein have been recovered. Using the normal and mutant sequences, determine the DNA and mRNA sequences that code for this portion of the protein, and explain each of the mutations. a. met-trp- b. met-cys-ile-val-val-leu-gln- c. met-trp-tyr-arg-ser-pro-thr- d. met-trp-tyr-arg-gly-ala-val-ile-ser-pro-thr-BM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation LeadpleIdentify the following mutations and describe what the possible effect on the protein will be. (4) 5’GAT TTT AGC TTA GCC CAT 3’ 5’ GAT TAG CTT AGC CCA T 3’ 3’CTA AAA TCG AAT CGG GTA 5’ 3’ CTA ATC GAA TCG GGT A 5’ 5’ GAT TTT AGC TTA CCC CAT 3’ 5’ GAT TTT AGC TAA CCC CAT 3’ 3’ CTA AAA TCG AAT GGG GTA 5’ 3’ CTA AAA TCG ATT GGG GTA 5’
- 5' UGG CAA UCC UAC GAU 3' - 1. Here is the MRNA sequence from a section of a gene (it is the middle of the sequence, so it has no AUG). What is the template sequence of this gene? - 2. Are any of these codons in the MRNA non-degenerate? If so, indicate which one. e 3. 4 a) Translate this mRNA section. Give the 3 letter codes for the amino acids. b) Indicate on the peptide which is the C terminus and which is the N terminus. e 4. Is it possible for a single base pair substitution to cause a truncation in this peptide? If so, e explain how. e 5. Write out the sequence of the anticodon in the tRNA that would bind to the fourth codon in the e MRNA. e 6. Write out a possible miRNA that could regulate the expression of this gene(ol soupe bannos96 SAM 3 A small strand of DNA has this sequence: 0pxbeter owl nade hoparg TACCGGAAACTG ATGGCCTTTGAC a. If the TOP strand is the template strand, what will be the mRNA made from this DNA read from left to right? What process allows for the mRNA to be made? b. If this is a eukaryotic mRNA, where does transcription occur? What would happen if the mRNA was not processed? c. What is the sequence of the protein made (use the genetic code below)? What process allows for the protein to be made?a) b) Shown below is a DNA sequence that encodes for a section of a protein. Please write the amino acid sequence using the three letter codes for this section. 5' ATG ACT CTC TCC TGG GGC ATC CGA TAA 3' What would the second codon be changed to if it was both a silent mutation and a transition mutation? Please write an anticodon in 5' to 3' direction that would recognize both the original second codon and the mutated second codon.
- Using the table of genetic code, choose the CORRECT protein sequence that will be produced from the following sense strand of DNA: 5'-AUG UCU GAC UAG TTG GAT CCC - 3' Second position First position (5' end) Third position (3' end) Phe Ser Tyr Cys U Phe Ser Тут Cys Leu Ser Stop Stop A. Leu Ser Stop Trp Leu Pro His Arg Leu Pro His Arg Leu Pro Gln Arg Leu Pro Gln Arg Ile Thr Asn Ser U Ile Thr Asn Ser Ile Thr Lys Arg A Met Thr Lys Arg Val Ala Asp Gly U Val Ala Asp Gly C Val Ala Glu Gly A Val Ala Glu Gly O a. Lys-His-Ala-Gly-Asn-Leu-Val O b. Val-Val-Ser-Pro-Leu-Asp-Thr1. The UAU and UAC codons in MRNA both specify What feature of the genetic code explains this? Second letter C UUU Phenyl- UUC alanine UAU UAC UCU Tyrosine UGU UGC Cysteine UCC Serine UCA UUA UUG UAA Stop codon UGA Stop codon UAG Stop codon UGG Tryptophan Leucine UCG CAU CÁC CUU CUC CUA CUG CGU CGC CCU CC CCA CCG Histidine Leucine CGA Arginine CGG Proline CAA CAG Glutamine AUU AUC Isoleucine A AUA AAU AAC Asparagine AGU ACU ACC ACA ACG AGC Serine Threonine AAA Methionine; start codon AGA AGG Arginine AUG AAG Lysine GUU GUC GAU Aspartic GAC acid GCU G GUA GUG GCC Alanine GCA GGA Glycine GGG GGU GGC Valine GCG GAA Glutamic GAG acid Chp 米 144 Third letter UCAG UCAGUCAGU CAG First letterWhat is the sequence of the mRNA transcript that will be produced from the following sequence of DNA? The top strand is the template strand, the bottom strand is the coding strand. 5’ – TCGGGATTAGACGCACGTTGGCATACCTCG – 3’ 3’ – AGCCCTAATCTGCGTGCAACCGTATGGAGC – 5’ Enter the mRNA sequence here (pay close attention to the direction of the molecule!): 5'-_____-3'
- 5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above sequence? Please use the one-letter code for your answers. (You will need to consult the Table of the Genetic Code for this question) 1st letter UUU Phe UCU UCC Leu UCA UCG U UUC UUA UUG CUU C CUC CUA CUG AUU A AUC AUA AUG U GUU G GUC GUA GUG CCU Leu CCC CCA CCG ACU lle ACC ACA Met ACG GCU Val GCC GCA GCG с Second Letter Ser Pro Thr Ala UAU UAC A | AAU AAC AAA AAG GAU GAC GAA GAG Tyr CAU CAC CAA Gin CAG 1 UAA Stop UGA Stop A UAG Stop UGG Trp G His Lys UGU UGC Asp Glu G 3rd Asn AGU Ser U letter AGC AGA AGG Cys U CGU CGC Arg CGA CGG GGU GGC GGA GGG DCAG DUAG DUCAG Arg Gly UCAGThe coding strand of DNA in a segment of a gene is as follows:ATG GGC CTT AGC. This strand carries the information to make aregion of a polypeptide with the amino acid sequence, methionineglycine-leucine-serine. What would be the consequences if a mutationchanged the second cytosine (C) in this sequence to an adenine (A)?Translate this RNA sequence into an amino acid sequence: 5'-AUG GGC UAC CGA-3'?