Read very carefully: Chymotrypsin cleaves peptides C TERMINUS to the aromatic amino acids. Trypsin cleaves peptides C TERMINUS to basic amino acids. Cyanogen bromide (CNBR) cleaves C-terminus to methionine residues. With this knowledge, reconstruct the following cleavage products and give the original peptide sequence. CNBR Chymotrypsin WITHHERISALLRIGHT ISTRYWITHM Trypsin EISAM YWITHMEISAMANINGCHEMI STR YWITHHER 1 The which convorted e Name.
Q: For the following tetrapeptide: CKSW a. Draw its complete protonic equilibria. Indicate the net…
A: Note that the tetrapeptide has 4 side chains, sulfydryl, amino, hydroxyl and a secondary amine. The…
Q: Riboflavin gives rise to cofactors: Select one: O a. All of them O b. FAD; FADH2 O c. NAD+; NADH d.…
A: Introduction: Riboflavin is likewise known as Vitamin B2. It is an important food supplement.…
Q: how do you do the following mechanism showing the cleavage of the peptide bond
A: Amino acids are joined together through peptide bonds to form a polypeptide. Peptide bonds are the…
Q: In the 1970s, scientists realized that there might be unforeseendangers and ethical issues with the…
A: An ecosystem is made up of the interactions of various species in a specific geographical area.…
Q: An uncatalyzed reaction has a rate of 4.2 x 10-7 sec-1. When an enzyme is added the rate is 3.2 x…
A: Enzymes are proteins present inside organisms, which function to work as biological catalysts. These…
Q: Does the acetyl-CoA required for ketone body synthesis transport through the inner mitochondrial…
A: Ketone bodies acetone, acetoacetate and beta hydroxybutyrate are produced from two (or 3) molecules…
Q: Are there any components found between the macromolecule test reagents (Benedict's, Iodine, Sudan…
A:
Q: Both reducing monosaccharide and disaccharide give positive results in Barfoed's test. Which of the…
A: Carbohydrates are the primary building blocks of all living organisms. Carbohydrates are all made up…
Q: Question 23 Explain the structure of your protein. (Up to 100 words) For the toolbar, press ALT+F10…
A: When asked to explain the structure of a protein, we must describe the primary, secondary and…
Q: Use a calculation based on the pH partition model to determine the likelihood that a weakly acidic…
A: According to the pH partition model, for a weakly acidic drug the Henderson-Hasselback equation is…
Q: Sample No. 1 2 3 4 5 Sample No. Sample Identity 1 2 3 A Table 1. Results of the Qualitative Tests of…
A: Copper Acetate test is used to distinguish oil and fatty acid. Copper acetate reagent does not react…
Q: Which of the following statements about protein is correct? (Choose three). * During polypeptide…
A: Introduction : Proteins are made of amino acids. A protein is made up of one or more chains of amino…
Q: Protein A interacts with biomolecule B and forms a complex AB, with a dissociation constant KD = 1…
A: Consider the following reaction: P + L ⇌k2k1 PL where P is the protein, L is the ligand and k1 and…
Q: Read instruction and answer question
A: Thermophilic bacteria live at higher temperatures such as hot springs and hot thermal vents. The…
Q: A sample was methylated and then digested, yielding a of 2,3-dimethylglucose and 1,2,3,6-tetramethyl…
A: Glucose is a carbohydrate and it acts as a primary energy source for the cells. Carbohydrates are…
Q: Muscle does not provide glucose for the brain during times of starvation. Why? You may choose more…
A: When subjected to a prolonged period of starvation, the level of glucose in the blood falls. This…
Q: What makes the lesson about carbohydrates important to our daily life?
A: Biological processes require several different macromolecules for their metabolic and functional…
Q: What would the order of elution be (first to last to come out of a size-exclusion chromatography…
A: Size exclusion chromatography is a technique for separating molecules based on their size and shape.…
Q: 1. Assign IUPAC names to each of the following small peptides. a. Gly-Ala-Leu b. Gly-Tyr-Ser-Ser C.…
A: As a general rule of writing peptides, the N-terminal is at the left and the C terminal is at the…
Q: Which of the following is not an example of spongiform encephalopathy Ochronic wasting disease…
A: Spongiform encephalopathy is a fatal disease that causes neurodegeneration. Its symptoms generally…
Q: a) 2-Hydroxy-carboxylic acids in the citric acid cycle and in glycolysis (3 answers): b) how do the…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: Question 4. If you were to synthesize a tetrapeptide consisting of all alanine residues, you would…
A: Tetrapeptide with all the alanine residues will be called polyalanine. These alanine residues will…
Q: Which of the following is true of the TCA cycle? It is independent of aerobic conditions. It is the…
A: Catabolism is the process by which complex molecules (consumed in the form of food) are broken down…
Q: what is the relationship of adding protein with a meal that contains simple carbohydrates with…
A: Diet is the amount of a particular combination of food that we take during the day. Diet contains…
Q: Word bank: oxygen, hydrogen, ionic, polar, nonpolar, hydrophilic, hydrophobic, hydrophobic force…
A: Introduction : In addition to being a polar molecule itself, water is also a solvent which is polar.…
Q: Draw the condensed structural formulas for the products of the reaction of which is catalyzed by…
A: Enzymes are the biocatalysts that speed up biochemical reactions. These are generally proteins. AST…
Q: For which of the following vitamins is blood coagulation a primary biochemical function usually…
A: Vitamins are essential nutrients that help humans in protection from diseases. Each of the vitamin…
Q: lycerophospholipid, glycerin's three -OH groups are esterified, respectively, with one fatty acid…
A: Sugar and phospholipids are the basic biomolecules which take part in multiple biological structures…
Q: Amylase is an enzyme that catalyzes the release of smaller sugar molecules from starch.…
A: α-amylase and α-glucosidase digest the carbohydrates to simple form i.e glucose, thereby increases…
Q: Protein A interacts with biomolecule B and forms a complex AB, with a dissociation constant KD = 1…
A: The reaction is:AB↔A+B, with dissociation constant being Kd=1μM at 298KA biochemist mutated the…
Q: We are outnumbered by the bacteria in our colon. Why don't they typically make us sick? a) They…
A: The human microbiome helps to maintain the intestine linings and prevents the growth of pathogenic…
Q: Macronutrients provide us the energy to live, move, and function. Evaluate the sentence above,…
A: Bioenergetics refers to the study of living system and it's energy transformations within and among…
Q: A type of protein hydrolysis that is generally used only in the determination of tryptophan.* A.…
A: Introduction: The process of protein hydrolysis involves the splitting of peptide bonds to form…
Q: What is the point prevalence on the end of January 2021? [ Each cold infection in represented by an…
A: Prevalence of a disease or infection identifies the persons suffering from a particular disease.…
Q: Fill in the blanks 1) The interactions between biomolecules and, proteins fold, and are exerted…
A: Amino acids are the structural units of proteins. Peptides are chains of amino acids joined through…
Q: Covalent and ionic bonds are the main features of nearly every biological molecule. Discuss how…
A: Introduction: A covalent bond is a chemical bond that includes the sharing of the electrons of two…
Q: An enzyme has 10 times greater affinity for substrate "A" than for substrate "B". Which of the…
A: Enzymes are bio-catalyst that participate in biochemical process and they are highly specific in…
Q: Distinguish the differences of photosynthesis in seawater and land plants
A: Photosynthesis is the production of glucose and oxygen from carbon dioxide and water by using light…
Q: In glycolysis, pyruvate kinase produces what high energy product and what low energy product?
A: Glycolysis is a pathway in which the Glucose (C6) is broken down into a 3 carbon product i.e. 2…
Q: The proton pump in ETC is an active transporter. Where does it get the energy to pump protons…
A: ETC is electron transport chain. It is located in inner membrane of mitochondria. It is involved in…
Q: (b) Why is selectivity of photodynamic very important? How can it be treatment achieved?
A: Photodynamic treatment involves use of molecules called photosensitizers which gets activated in the…
Q: 1) give detail note ( giving points ) on three generation of photosensitizer (PSS) with example…
A: Photodynamic Therapy consists of three components: a photosensitizer: a chemical species that…
Q: Describe the precipitants of ketoacidosis
A: Ketoacidosis is a metabolic state characterized by abnormally high ketone body concentrations in the…
Q: This test gives yellow solution, indicating the presence of proline* A. Biuret B. Ninhydrin C.…
A: Different of the tests mentioned here are tests for detection of amino acids. In the next step we…
Q: at is nitrogen fixation
A: Answer for the following question is :
Q: 2. Suppose you had allowed your dialysis experiment to continue for several days (with the beaker…
A: As given in the question, the dialysis experiment was continued for days with the beaker covered,…
Q: what is the N and C terminal amino acid residues of
A: A protein is a sequence of amino acids when we draw the structure of peptide or protein…
Q: Hydroxylation of proline and lysine residues in collagen structure, leads to creating more Select…
A: Collagen is a structural protein. It is a long, inelastic, tripple-stranded helical structure.…
Q: which step of the polymerase chain reaction takes place at 98 degrees?
A: It is an enzymatic process by which specific segments of DNA can be amplified by using a primer,…
Q: Question displayed in picture. Choices are : neurons, fat, blood brain barrier, liver, muscle,…
A: According to the graph, blood glucose concentration rises as the rate at which glucose is…
Step by step
Solved in 4 steps
- When sequencing proteins, one tries to generate overlapping peptides by using cleavages at specific sites. Which of the following statements about cleavages caused by particular chemicals or enzymes are true? Cyanogen bromide cleaves at the carboxyl side of threonine. Chymotrypsin cleaves at the carboxyl side of aromatic amino acids. Trypsin cleaves at the carboxyl side of Lys and Arg. Chymotrypsin cleaves at the carboxyl side of aspartate and glutamate.The following is a portion of a protein: met-trp-tyr-arg-gly-pro-thr-Various mutant forms of this protein have been recovered. Using the normal and mutant sequences, determine the DNA and mRNA sequences that code for this portion of the protein, and explain each of the mutations. a. met-trp- b. met-cys-ile-val-val-leu-gln- c. met-trp-tyr-arg-ser-pro-thr- d. met-trp-tyr-arg-gly-ala-val-ile-ser-pro-thr-H CH₂ H₂C HC-CH3 CH₂ H H₂C (S) H₂C H CH₂ CH₂ CH₂ NH O C NH NH₂ a) Which of the following statements about this peptide are correct? Group of answer choices Treatment of this peptide with trypsin generates two products. This peptide is a substrate for carboxypeptidase A Treatment of this peptide with cyanogen bromide generates a pentapeptide and a tripeptide. Treatment of this peptide with chymotrypsin generates three products. Treatment of this peptide with elastase generates 2 products. None of the above statements are correct. b) What is the sequence of this peptide using one letter abbreviations? c) What is the pH which would correspond to the ionization of the peptide as drawn above? 1, 5, 7, 10, 14
- There is another melanocyte-stimulating hormone called β-melanotropin.Cleavage of β-melanotropin with trypsin produces the following peptidesplus free aspartic acid. WGSPPK DSGPYK MEHFRIf you assume maximum sequence similarity between α-melanotropin andβ-melanotropin, then what must the sequence of the latter be?Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?Complete the protein synthesis for the partial DNA sequence for a normal FGFR3 gene (TOP) and mutated FGFR3 gene (BOTTOM). Remember, when filling in mRNA, use capital letters only. When filling in amino acids, use three letters, with the first letter capitalized. If you do not use this format, your answer may be marked wrong. DNA CCG TTC GGG GAA ССС MRNA Amino Acid DNA CCG TTC GGG GAA TCC MRNA Amino Acid
- Original sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3(a) Write a possible sequence for an mRNA segment coding for apamine.(b) Do you think apamine is synthesized in the form, or is it more likely a product of proteolytic cleavage of a larger peptide? Explain.Consider the following DNA sequence, which codes for a short polypeptide: 5'-ATGGGCTTAGCGTAGGTTAGT-3' Determine the mRNA transcript of this sequence. You have to write these sequences from the 5' end to the 3' end and indicate those ends as shown in the original sequence in order to get the full mark. How many amino acids will make up this polypeptide? Determine the first four anticodons that will be used in order to translate this sequence.
- A tridecapeptide yields the following fragments when partially hydrolized. Determine the sequence of amino acids in the tridecapeptidedrolyzed. Determine the sequence of the tri decapeptide. tridecapeptide à lys-arg + gly-phe-pro + phe-ser-asp-lys + pro-phe-ser + asp-lys-arg-val + gln-ala-tyr + val-trp-gln. Determine the sequence of amino acids in the tridecapeptideWhich of the following is the polyadenylation signal sequence? AAAAAA AAUAAA O AAAUAA O AAUUAAA protein has been sequenced after cleavage of disulfide bonds. The protein is known to contain 3 Cys residues, located as shown here. Only one of the Cys has a free —SH group, and the other two are involved in an —S—S— bond. The only methionine and the only aromatic amino acid (Phe) in this protein are in the positions indicated. Cleavage of the intact protein (i.e., withdisulfide bonds intact) by either cyanogen bromide or chymotrypsin does not break the protein into two peptides. Where is the —S—S— bond (i.e., AB, BC, or AC)?