For each example: a. fill in the complimentary DNA strand b. fill in the correct mRNA bases by transcribing the bottom DNA code c. fill in the correct tRNA bases d. translate the mRNA codons to find the correct amino acids Evample #1
Q: During transcription the strands of DNA unwind due to the action of
A: Transcription and replication are processes that need access to DNA. DNA is usually tightly coiled…
Q: Which dna strand will be synthesized continuously during dna replication? a.The strand that is…
A:
Q: The function of RNA polymerase is to A) catalyze the formation of phosphodiester bonds between…
A: Gene expression is the process thorough which the DNA directs to form proteins. It involves two…
Q: transcribed RNA
A: Transcription is the process of copying a segment of DNA into RNA. Only one of the two DNA strands…
Q: Look at the picture carefully below and imagine inside a cell nucleus. a) encircle and name the…
A: The genetic material or DNA consists of a double helical structure with a backbone of…
Q: Describe what happens to the DNA when the helicase unwinds the double helix. What can Topoisomerases…
A: it occurs during DNA replication.
Q: Figure 1 Figure 2
A: DNA is known as the deoxyribonucleic acid. DNA has the chromosome which carries the genes and these…
Q: Topoisomerases (a) synthesize DNA (b) synthesize RNA primers(c) join Okazaki fragments (d) break and…
A: The biochemical molecule that is built up with two polynucleotide chains is called DNA…
Q: Why was the cold ethanol added to the soap and salt mixture?
A: DNA - is Deoxy Ribo Nucleic acid is a hereditary material which contains all the genetic information…
Q: In Eukaryotes, DNA is a long molecule inside a tiny nucleus. a. How can this long chain fit in such…
A: DNA (deoxyribo nucleic acid) is genetic material of the cell. In case of eukaryotes, DNA is…
Q: Consider how histone proteins bind to DNA and then explain why a salt solution with a high…
A: DNA is deoxyribonucleic acid and is composed of two chains of the polynucleotide. These coil around…
Q: The template strand of DNA is 3’AGGATGCACGTAC5’ The sequence of the mRNA that is made from this DNA…
A: The RNA sequence would be same as coding strand (except thiamine is replaced by uracil) and opposite…
Q: How are rare bases incorporated into tRNAs? a. Encoded by guide RNAs b. By chemical changes to one…
A: RNA contains four types of nucleotides adenine, guanine, cytosine, and uracil. In addition to these…
Q: helps create a strand of mRNA by using DNA as a template. a. RNA polymerase b. DNA polymerase c.…
A: a.) RNA polymerase. The creation of mRNA from the DNA . This mRNA is made with RNA polymerase…
Q: DNA polymerase III is a processive enzyme, which means that a. it does not dissociate from the…
A: Ribonudeic acid is produced by an enzyme called RNA polymerase, which is responsible for the…
Q: DNA replication is said to be semiconservative because a. one of the new molecules conserves both of…
A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: Which of the following best describes tRNA? a. Provides the instructions for the amino acid…
A: Translation is the process of formation of amino acids from mRNA sequence.
Q: Which of the following is true about DNA polymerase?a) It can synthesize DNA in the 5’ to 3’…
A: DNA polymerase is an enzyme that synthesizes DNA molecules from deoxyribonucleotides, the building…
Q: Considering the given sequence of nucleotides in an mRNA molecule, (a) what is the sequence of the…
A: Gene expression is the process by which the instructions in the DNA are converted to functional…
Q: Refer to the figure to answer these questions:a. Add labels for mRNA (including the 5′ and 3′ ends)…
A: The central dogma in both prokaryotic and eukaryotic cell comprises of replication of parent…
Q: D) Draw the first two (2) base pairings of the DNA molecule from the 5' end and label all key…
A: The self replicating biomolecules that are present in the chromosomes and carry genetic information…
Q: DNA Polymerase holoenzymes used for DNA replication recognizes A. double-stranded sequences as…
A: DNA polymerase III holoenzyme (Pol III HE) is an enzyme that catalyzes elongation of DNA chains…
Q: To make a new DNA strand, which of the following is necessary? a. A template strand c. Heavy…
A: The separating process of strands of the double helix would provide two templates for the synthesis…
Q: Which is not a property of DNA polymerase? a) It requires a primer to begin synthesis b) It adds…
A: Note : As many questions have been asked, only the first multiple choice question (question number…
Q: Which is true about eukaryotic cDNA? Choose all that apply a. it is single stranded b. it is made…
A: Complementary DNA is abbreviated as cDNA. This form of DNA has a wide range of applications. Genes…
Q: Transcription is similar to DNA replication because both processes_______ . a. use the same enzyme…
A: Replication and transcription have a lot in common. Watson-Crick base-pairing rules are followed.…
Q: D. Fill in the table below. Determine the correct template and coding strands to properly answer…
A: DNA is a double helical macromolecule that has genes that contain the necessary information for the…
Q: Okazaki fragments are short DNA pieces that explain how the DNA polymerase can continue the…
A: * Okazaki fragment are short sequences of DNA nucleotides. * They are of approximately 150 to 200…
Q: Eukaryotes such as humans have linear chromosomes. In order to signal the end of DNA replication,…
A: DNA replication is a process by which two identical copies of DNA are made. It is completed in 3…
Q: DNA primase RNA primer DNA ligase DNA Polymerase (Pola), 3' Lagging strand Okazaki fragment 5'…
A: Topoisomerases (or DNA topoisomerases) are enzymes that participate in the overwinding or…
Q: Give two examples of places you could have mutations in the DNA sequence of a eukaryotic gene that…
A: The change in the heritable characteristics of the species across many generations is called…
Q: a. Give the sequence of mRNA that would be transcribed off of the bottom strand and label its 5' and…
A: The given DNA, 5'- ATGTCGACGCGCAGGTGA - 3' 3' - TACAGCTGCGCGTCCACT - 5'
Q: (a) Write the complementary base sequence for the matching strand in the DNA section shown below:.…
A: DNA is a double stranded helical structure present inside the nucleus. It acts as a hereditary…
Q: Compare and contrast exons and introns
A: Introduction - Noncoding regions of an RNA transcript or the DNA encoding it that are spliced off…
Q: . Translation a)Explain the role of ribosomes in the process of protein translation.b. Explain the…
A: “Since you have asked a question with multiple sub-parts, we will solve the first three sub-parts…
Q: After transcription, the molecule that is formed is a.complementary to part of one strand of DNA.…
A: Transcription is the process that is catalyzed by the RNA Polymerase enzyme. In this process a…
Q: What is the function of resolvase in recombination? a. It unwinds double-stranded DNA. b. It allows…
A: Recombination is an exchange of genetic information among DNA molecules. It is an essential genetic…
Q: Following transcription, the RNA has a complementary sequence of which of the following? Question 9…
A: The process of copying of DNA segment onto an RNA using enzymes and nucleotides is called as…
Q: The problem of synthesizing the lagging strand, in the sense that DNA synthesis can only occur in…
A: DNA synthesis is the formation of new DNA molecules from the parental strand by utilizing…
Q: Which feature do you expect to find at an origin of replication? a) an ATG codon b) A GC-rich…
A: DNA replication is the process by which new DNA molecules are produced from the old DNA molecules by…
Q: Differentiate between the followings:(a) Repetitive DNA and Satellite DNA(b) mRNA and tRNA
A: Deoxyribonucleic acid (DNA) is a molecule composed of two polynucleotide chains. It coils around…
Q: Translate a mRNA sequence into a protein sequence using the genetic code. 2) write the…
A:
Q: Which statement regarding transitions and transversions is TRUE? a) An adenine to guanine change is…
A: Genetic mutation refers to the permanent alterations in the nucleotide sequence of a DNA molecule…
Q: Which statement regarding UTRs is TRUE? a) Transcription begins at the start of the 5' UTR b)…
A: UTR stands for untranslated region in mRNA.
Q: Given the following DNA strand: TACAGAGATAACCGAATT A. Write the corresponding strand that would…
A: Introduction Deoxyribonucleic acid, or DNA, is a molecule that holds the instructions that allow an…
Q: Create the RNA strand to be synthesized from the DNA double strand below and explain this synthesis,…
A: DNA are double helical structures that contains genetic information, which is responsible for almost…
Q: In the sequences below, which is the coding strand and which is the template strand? A. 5-…
A: The strand of DNA which serves as the template for the mRNA synthesis during transcription is called…
Q: Create the RNA strand to be synthesized from the DNA double strand below and explain this synthesis,…
A: Transcription of DNA into mRNA and translation of mRNA into protein is known as the central dogma of…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
Trending now
This is a popular solution!
Step by step
Solved in 3 steps with 1 images
- Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?For each of the following items, fill in either the DNA strand, the MRNA codons, the tRNA anticodons, or the amino acid sequence that have been left blank. If several sequences might work, choose only one. Furthermore, circle the start and the stop codons of each mRNA sequence. 1. DNA (3'-5') ACG TAC GGC CGG TTA AAG CAT ACT TTC TTG MRNA TRNA Amino Acid 2. DNA (3'-5') MRNA AUG ACU AGC UGG GGG UAU UAC UUU UAG AAA TRNA Amino Acid 3. DNA (3'-5') MRNA TRNA GCU CCU UAC CAC ССС CGU AUG GCU GGG AUC Activate Go to Sett Amino AcidConsider the following DNA sequence, which codes for a short polypeptide: 5'-ATGGGCTTAGCGTAGGTTAGT-3' Determine the mRNA transcript of this sequence. You have to write these sequences from the 5' end to the 3' end and indicate those ends as shown in the original sequence in order to get the full mark. How many amino acids will make up this polypeptide? Determine the first four anticodons that will be used in order to translate this sequence.
- Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.First Letter A G U с 22. Using the provided "Genetic Code-Reference" answer the following question. Based on the following DNA template strand, write out the amino acid chain produced. 23. Consider the following mRNA base codon sequence 5'-AUC-GAA-3' and the provided "Genetic Code-Reference". Genetic Code-Reference UUU UUC UUA UUG CUU CUC CUA CUG (mutated or silent) (mutated or silent) b. Briefly explain your reasoning for each. (be sure to include both parts) AULLY AUU a. Label which of the following would result in a mutated amino acid sequence or a silent mutation. (May help to first determine the original amino acid sequence, then compare to mutations) U Phe mRNA codon sequence: anticodon sequence: amino acid sequence: Leu Leu 5'-AUA-GAA-3' Val 5'- AUC-GAC-3' AUC Ille AUA AUAJ *AUG Met/Start GUU GUC GUA GUG UCU UCC UCA UCG) CCU) CCC ccc CCA 000 CCG ACU ACU ACC ACA ACG, C GCU GCC GCA GCG Second Letter Ser Pro Thr 3'-CAA-GTC-TGT-5' Ala UAU UAC) Tyr Туг A **UAA Stop UAG Stop CAU] CACJ…Use a codon chart determine the amino acid sequence. Remember to read through the strand and ONLY start after the promoter and STOP when it tells you to stop. Follow example below: Example: DNA AGA TATA TAC CTC CGG TGG GTG CTT GTC TGT ATC CTT CTC AGT ATC MRNA O protein AUG GAG GCC ACC CAC GAA CAG ACA UAG GAA GAG UCA UAG start-glu-ala-thre-hist - asp-glu-threo-stop met DNA CCT ATA TAC ACA CGG AGG GTA CGC TAT TCT ATG ATT ACA CGG TTG CGA TCC ATA ATC mRNA DGGA UAU) AUG uGul Gcc nccl cAul GCol protein ly Tur MeT cys AlA ser HIJ Ala 2 3 4 DNA AGA ACT ATA TAC CTC TTA ACA CTC TAA AGA CCA GCA CTC CGA TGA ACT GGA GCA mRNA protein DNA TAT ATAC CTT GGG GAA TAT ACA CGC TGG CTT CGA TGA ATC CGT ACG GTA CTC GCC ATC mRNA protein D DNA TAA ACT ATA TAC CTA GCT TAG ATC TAA TTA CCC ATC mRNA protein Auu UGA UAU AGU GAUCGA AUC MAG Auu AAU leu Stop. TRY-Met-Asp- ARG-Isle-Stop-Ile. Asn DNA CTA TTT ATA TAC TAG AGC GAA TAG AAA CTT ATC ATC mRNA protein D DNA CAT ATA TAC CTT AGT TAT CCA TTG ACT CGA ATT GTG CGC TTG…
- If DNA segments changes from GCATAG to GCATA, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base U A G 0001 Phenylalanine UCU UAU1 Tyrosine (Tyr) UAC UGUT FCcysteine (Cys) UGCJ U UUCJ (Phe) UCC Serine (Ser) UCA U UUA1 UAAT UGA - Stop A FLeucine (Leu) UUG- FStop UAG- UCG- UGG - Tryptophan (Trp) G CU- CCU CGUT CAU1 Histidine (His) CAC U CUC FLeucine (Leu) CUA CC Proline (Pro) CCA CGC FArginine (Arg) CGA CAA1 Glutamine A CAGI (Glu) CGG- CUG- CCG- G AUU AAU1 Asparagine ACU1 AGUT FSerine (Ser) AGC- AUC FIsoleucine (le) ACC Threonir AACJ (Asn) A AUA- ACA (Thr) AAA1 FLysine (Lys) AAG- AGA, FArginine (Arg) AGG- A Start Methionine (Met) ACG- AUG - GUU- GCU GAU- GGU | Aspartic Acid GAÇJ(Asp) U GỤC Valine (Val) GUA GCC FAlanine (Ala) GGC Glycine (Gly) GGA G GAA1 Glutamic Acid A GCA GCG- GAGJ (Glu) GGG- GUG- GWrite the sequence of the mRNA molecule synthesized from a DNA template strand having the sequence 5'-ATTACAGGCGGT-3' 5'- UAAUGUCCGCCA Incorrect Write the amino acid sequence encoded by the mRNA base sequence 5'-GAGUUAGUUUGUAAGUGC-3' Assume the reading frame starts at the 5' end. Refer to the codon table . Amino acid sequence: Glu-Leu-Val-Cys-Lys-Cys What is the sequence of the polypeptide formed on addition of poly(UUAC) to a cell-free protein-synthesizing system that does not require a start codon? Enter an amino acid sequence of four amino acids using the three-letter abbreviations. Polypeptide sequence: Poly( -3' Glu-Leu-Val-Cys-Lys-Cys-Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the complementary mRNA sequence for each of the following DNA sequence. A: TACCTAGCGCACATGTAGGTGGGCAAAGTT B: TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG -If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTT
- Given the following DNA sequence of the template strand for a given gene: 5' TTTCCGTCTCAGGGCTGAAAATGTTTGCTCATCGAACGC3' Part A ) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends). Part B ) Use the genetic code to write the peptide sequence translated in a cell from the mRNA in part A. Please use the 3 letter abbreviation for each amino acid. Part C: How would the peptide synthesized in a cell be different if the mRNA was translated in vitro (i.e. not in the cell)?Order of bases in DNA Order of bases in MRNA (codon) AUC Order of bases in tRNA (anticodon) UAG TAG Amino acid coded into proteins CAT CAU GUC CCA ATG Methionine (Met) Valline (Val) GUU, GUC, GUA, GUG ACU ACA UGU AAA AAA GAA CuU Procedure: Refer to the Genetic Code Table below to identify the right amino acid coded. To determine the order of bases in the first column (UNA), second column (codon) and the third column Is the anticodon. Consider the complementary base pair, in DNA and in RNA To identify the amino acid, took at the bases in the MRNA codon, example AUG using the Genetic Code Table. Loo: for the first letter of the MRNA codon on the left side of the genstis code table (A), the second letter of the MRNA on the second letter column (U), and the third letter on the right-side column (G). AUG codes for the amino acid -methionine. Do the same with the other codons in the chart. Genetic Code Table and posticn of codon Cystelne Cysteine UAU TyrY UAC Tyr Y Tyrosine USA UAG CAU His H…Refer to the DNA sequence provided:3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNAin (a)? (The question for A is this: What is the mRNA transcript of the anticoding strand of the DNA model?)