please help me with this question.As this is a non-directional cloning, recombinant plasmids can contain an insert ligated into the vector in two different orientations. Provide two diagrams to illustrate the two potential recombinant plasmids, with the inserts ligated in opposite orientations. Include all RE sites and distances between sites on the diagram. You now plan to clone the PCR amplicon for the WT FANCG gene into the Pyull site of plasmidD.Green as illustrated below. The PCR product is a linear, blunt-ended dsDNA molecule of 360bp, with an Afal deavage site at position 354. pGreen is 2000 bp is size and contains the GFP(green fluorescent protein) gene, which upon expression in a bacterial hosts results in greencolonies. It also contains a penicillin resistance gene (Pen) and three unique RE sites withcut site positions and distances between them as indicated on the diagram.PCR product 1BamHI600 bpEcoRIavadpGreen2000 bo300-60360

In order to create DNA fragments with specified complementary end sequences which can be linked…

please help me with this question. As this is a non-directional cloning, recombinant plasmids can contain an insert ligated into the vector in two different orientations. Provide two diagrams to illustrate the two potential recombinant plasmids, with the inserts ligated in opposite orientations. Include all RE sites and distances between sites on the diagram.

please help me with this question. As this is a non-directional cloning, recombinant plasmids can contain an insert ligated into the vector in two different orientations. Provide two diagrams to illustrate the two potential recombinant plasmids, with the inserts ligated in opposite orientations. Include all RE sites and distances between sites on the diagram.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter13: An Introduction To Genetic Technology

Section: Chapter Questions

Problem 20QP: Analyzing Cloned Sequences A base change (A to T) is the mutational event that created the mutant...

See similar textbooks

Similar questions

You have a 5.3 kb PstI fragment cloned into the PstI site of the vector pUC19, which is 2.7 kb in size. This vector has unique sites for the following enzymes in a multiple cloning site: PstI, HincII, XbaI, BamHI, SmaI, EcoRI A restriction map of the 5.3 kb insert is prepared. The recombinant plasmid is digested with the enzymes listed above in single digests, and then several combinations of enzymes are tested in double digests. The following bands are observed when the digests are run on a gel: Use the data above to construct a map of the cloned insert. Note that fragments smaller than 100 bp will not usually be visible on a gel, and that 2 fragments with a similar size will run at the same spot on a gel – resulting in a brighter band.
You are interested in synthesizing a variant of Synechocystis sp. pcc 7803 ferredoxin having mutation (E) at its 38th residue. The gene is encoded in a pET21b vector (5.3 kbp). Estimate the amount of time needed to run a PCR for the site-directed mutagenesis for25 vs 30 cycles.
Clone number in this case is number 196 which is shown in the images. State whether a BamHI site has been re-created at the forward- and the reverse-end junctions of the human DNA with the plasmid vector band sizes are shown in one of the images. (0.5, 1, 2, 3, 4, 5, 6, 8, 10kb)
Primers designing for epitope tagging: Design forward and reverse primers to amplify the following gene with 6×HIS-tag on the N-terminus of the protein. To be cleaved and inserted into the plasmid, add restriction sites for EcoRI and HindIII at 5' and 3'. ATGCTCTCCGCCCTCGCCCGGCCTGTCAGCGCTGCTCTCCGCCGCAGCTTCAGCACCTCAGCC CAGAACAATGCTAAAGTAGCTGTGCTAGGGGCCTCTGGAGGCATCGGGCAGCCACTTTCAC TTCTCCTGAAGAACAGCCCCTTGGTGAGCCGCCTGACCCTCTATGATATCGCGCACACACCC GGAGTGGCCGCAGATCTGAGCCACATCGAGACCAAAGCCGCTGTGAAAGGCTACCTCGGAC CTGAACAGCTGCCTGACTGCCTGAAAGGTTGTGATGTGTAA
Clone number in this case is number 196 as shown in the images. What is the exact length of the segment of human DNA that has been inserted into the plasmid? *report the entire length of the insert, not just the sequences matching the ends and labels of wells isn't needed for answer*
Map of pUC18 is shown on the here. Describe how to select recombinant clones if a foreign DNA is inserted in to the polylinker site of pUC18 and then introduced into E. coli cells.. Hindll Sphl Sbfl Pstl BspMI Acci Hincli Sall Xbal BamHI Aval Smal Xmal Acc651 Kpnl Banll Eco53kl Sacl Apol ECORI lacz MCS LacR binding site Plac PUC18 Amp 2686 bps PMB1 ori
The map of plasmid pUC19 is shown below. The restriction site coordinate is the position of the 5’base on the top strand of each site sequence. The restriction enzyme sites are in bold type if there is only one site in pUC19. Please list the fragments in order of size, largest to smallest, which will result from a complete digestion by the restriction enzyme PvuII. Please list the fragments in order of size, largest to smallest, which will result from a complete digestion by the restriction enzyme DrdI.
The sequence 5' GCCTAATGCGTTCATAATGGCGTTTGCCACGGACGTAAAGTCGT 3' represents 50% of a PCR product which is cloned into a 1.5 kb plasmid for bacterial expression. What would the agarose gel look like, including a lane for markers, and where would the following pieces of DNA run: 1. the PCR insert 2. the empty uncut plasmid 3. the empty plasmid cut with a single restriction enzyme 4. the cloned plasmid containing the insert
As a part of undergrad lab project, you have to clone Your Favorite Gene into plasmid cloning vector (4740 bp) pUC18. Restriction maps for both YFG and cloning vector are provided. The plasmid has a bacterial origin of replication (ori), an ampicillin resistance gene (AmpR) that degrades ampicillin antibiotic. It also has LacZ gene that encodes the β-gal enzyme, which converts white X-gal substrate into a blue product. pLac is a bacterial promoter. Restriction Enzyme Recognition Site : A slash (/) represents the cut site for each restriction enzyme. Enzyme 1 5’- G/TCGA C -3’ 3’- C AGCT/G-5’ Enzyme 2 5’-C/TCGA G-3’ 3’G AGCT/ C5’ Enzyme 3 5’- GTC / GAC- 3’ 3’- CAG / CTG- 5’ Enzyme 4 5’-C AATT /G-3’ 3’-G/ TTAA C-5’ Enzyme 5 5’C AATT/G-3’ 3’G/TTAA C-5’ Enzyme 6 5’G/GATC C-3’ 3’C CTAG/ G-5’ Enzyme 7 5’G/GATC C-3’ 3’C CTAG/ G-5’ 1a) The table below shows restriction enzyme pairs used by various teams to digest the YFG and clone it in the…
An optimum ligation reaction should contain approximately 50 ng of vector. Given yourconcentrations recorded below, what is the volume of vector that should be added to eachligation reaction to have this mass of DNA in the reaction? Size of asPink-promoterless in bp: 702 (vector) Size of pCusC in bp: 157 The concentration of digested & purified PCR insert: 13.849 The concentration of digested and purified plasmid: 6.887 Any help with this is appreciated. I'm a bit confused thx
You want to clone a specific PCR amplicon. You have determined that the amplicon you want to clone has enzyme restriction sites for HindIII and EcoRI. After investigation you have seen that the pUC18/19 plasmid also have these enzyme restriction sites in its multiple cloning site (MCS on map included). After enzyme digestion your amplicon is 854 bp long. What length will the recombinant plasmid be after you have inserted your amplicon? Show a calculation.
As this is a non-directional cloning, recombinant plasmids can contain an insert ligated into the vector in two different orientations. Provide 2 diagrams to illustrate the 2 potential recombinant plasmids, with the inserts ligated in opposite orientations. Include all RE sites and distances between sites on the diagram.