Put the following DNA replication events in the correct order: Primase synthesizes an RNA primer. The initiator protein binds the origin. Ligase seals up the nicks in the lagging strands. DNA polymerase synthesizes the newly replicated strand in a 5' to 3' direction. Helicase unwinds the DNA. DNA exonuclease removes mispaired nucleotides in the newly replicated strand. 5 6 4 3 1 2 > >

Put the following DNA replication events in the correct order: Primase synthesizes an RNA primer. The initiator protein binds the origin. Ligase seals up the nicks in the lagging strands. DNA polymerase synthesizes the newly replicated strand in a 5' to 3' direction. Helicase unwinds the DNA. DNA exonuclease removes mispaired nucleotides in the newly replicated strand. 5 6 4 3 1 2 > >

Name: answere is wrong i need help identifying the right otder in where they
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: answere is wrong i need help identifying the right otder in where they go Put the following DNA replication events in thecorrect order:Primase synthesizesan RNA primer.The initiator proteinbinds the origin.Ligase seals up thenicks in the laggingstran

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 23QP: How does DNA replication occur in a precise manner to ensure that identical genetic information is...

See similar textbooks

Similar questions

Match the enzymes involved in DNA replication with their function. Primase [ Choose ] [ Choose] Synthesizes short RNA segment to initiate new DNA strand Helicase Main enzyme that extends RNA primer by adding DNA nucleotides to it Stabilizes single-stranded DNA Relieves over-winding of DNA ahead of the replication fork Removes RNA primers preceding Okazaki fragment and replaces RNA nucleotides with DNA nucleotides Single-stranded binding proteins Unwinds DNA helix Synthesizes the ends of the linear chromosome Seals nicks between adjacent DNA segments DNA polymerase III [ Choose ] DNA polymerasel [ Choose ] DNA Ligase [ Choose ] Topoisomerase [ Choose ]
Place the following steps of DNA replication in order (from left to right) from the beginning to the end of the process. Reset Help priming of DNA synthesis with RNA primer removal of primers by DNA polymerase I exonuclease elongation of RNA primers by DNA polymerase III opening and stabilizing the DNA strands joining of Okazaki fragments by DNA ligase Beginning of replication End of replication
DNA polymerases are processive, which means that they remain tightly associated with the template strand while moving rapidly and adding nucleotides to the growing daughter stand. Which piece of the replication machinery accounts for this characteristic? Helicase Sliding Clamp Single Stranded Binding Protein Primase
Which of the following replication proteins is incorrectly paired with it’s function? DNA polymerase - adds nucleotides to the growing strand Single stranded binding proteins - hold the DNA strands apart while they are being replicated Ligase - enhances separation of DNA strands Topoisomerase - relieves torsional stress due to unwinding by the DNA Primase - synthesizes a short RNA sequence to initiate replication
In what order does initiation of DNA replication proceed (from 1 = first to 4 = last)? DNA polymerase adds nucleotides DNA unwinds at the origin of replication Primase synthesizes RNA primers Helicase opens up replication forks, which extend in both directions
The region of DNA, shown below, is being copied. Diagram what happens when the second GT repeat (newly synthesizing strand) slips out (loops out). Diagram what occurs in this and the next round of DNA replication. Describe the change in the DNA sequence that occurs due to this replication slippage. 5’TGCCAGTGTGT3’ACGGTCACACACACATGGAG5’
Match the following descriptions with the enzymes involved in DNA replication. Adds an RNA primer to begin elongation Removes the RNA primer from the beginning of the newly constructed strands Splices lagging strand segments Cleaves the rung of the DNA double helix ladder Description: Answer Answer Answer Answer Enzyme: Helicase DNA Polymerase Primase DNA Ligase
Match each protein involved in DNA replication with its correct function in E. coli. An answer can be used more than once. Group of answer choices The major DNA replicating enzyme on both leading and lagging strands Relieves torsional stress upstream of replication forks Unwinds the double helix at replication forks Provides DNA polymerase III with a 3'-OH group paired with a DNA template Extends lagging strands at the ends of linear chromosomes Digests RNA…
Some Processes Involved in DNA Replication The replication origin is identified. DNA primase builds RNA primer. Okazaki fragments are spliced by DNA ligase. Helicases bind and uncoil the DNA double helix. RNA primer is the starting point for DNA polymerase. DNA replication ends at the telomere where DNA codes for termination. DNA polymerase adds complementary nucleotides in the 5' to 3' direction in short segments called Okazaki fragments. The sequence in which the events numbered above occur during DNA replication of the lagging strand is:
Some Processes Involved in DNA Replication The replication origin is identified. DNA primase builds RNA primer. Okazaki fragments are spliced by DNA ligase. Helicases bind and uncoil the DNA double helix. RNA primer is the starting point for DNA polymerase. DNA replication ends at the telomere where DNA codes for termination. DNA polymerase adds complementary nucleotides in the 5' to 3' direction in short segments called Okazaki fragments. The sequence in which the events numbered above occur during DNA replication of the lagging strand is Answer, Answer, Answer, Answer, Answer, Answer, and Answer.
Describe the role of the proteins involved with DNA replication. Also identify if the protein is involved the leading strand, lagging strand or both. DNA Ligase DNA Polymerase I DNA Polymerase III Helicase Primase Single-stranded DNA-binding proteins Topoisomerase
Which of the following statements about DNA replication is INCORRECT? It is powered bythe hydrolysis of ATP. Each strand withinthe DNA double helix is used as a template for synthesis of a new strand. It requires that both strands of the double helix be separated from each other. It proceeds withthe addition of new nucleotides to the 3′ end of a growing DNA strand. It begins atmultiple origins of replication sites along eukaryotic chromosomes.