Answered: Put the following Penicillium sp.…

Put the following Penicillium sp. structures in order from nearest to the Sab agar block (1) to furthest from the Sab agar block (4). Septate Hypha Conidiophore Sterigma Conidiospores

An Illustrated Guide To Vet Med Term

4th Edition

ISBN:9781305465763

Author:ROMICH

Publisher:ROMICH

Chapter3: Meat And Bones

Section: Chapter Questions

Problem 9MC

See similar textbooks

Related questions

Q: Compare and contrast the social organization of orangutans, gorillas, and common chimpanzees.…

A: Orangutans, gorillas, and chimpanzees are all intelligent and sociable species, yet their social…

Q: n I get help on this soon please?? I do not understand and I am stuck. This is a microbiology…

A: Rhizobium and mycorrhizae: These are the two distinct types of symbiotic relationships established…

Q: Is tiktaalik more closely related to ray-finned or lobe-finned fish?

A: The question is asking about the evolutionary relationship between Tiktaalik, a prehistoric…

Q: 3'- AATAAAAAAGGTCCCAAAAAATTAGGGGAGACGGTACATAAA GAGTAGAGTCATAAATTTTAGAGATGCGTA - 5'

A: Following the hints and considering the complementary strand is required:Complementary DNA strand:…

Q: How does distance of the light source relate to the changes in diversity of plant life in different…

A: The distance of the light source (sun) affects plant diversity in two ways: Light Intensity &…

Q: Question 1 Table 1: Genotypes and Phenotypes for Purple and Yellow Corn Kernels Type of corn…

A: Type of cornGenotype(s)PhenotypePurple kernelsPP or PpPurple kernelsYellow kernelsppYellow kernels…

Q: 80 Refer to figure 1A of the Science Article. The reduction in animal weight with exposure to higher…

A: The objective of the question is to interpret the data given in the figure 1A of the Science Article…

Q: What would cause someone to be immunocompromised? How does this compromised state alter its ability…

A: An individual can become immunocompromised due to a variety of reasons. These can include genetic…

Q: Part 2 Bio Question 6

A: The question is asking where we would expect the Pitx1 gene to be expressed in a fish that has…

Q: The ploidy of this structure is Haploid Gametophyte Diploid Sporophyte

A: The ploidy of this structure is Gametophyte.Explanation:Let's delve deeper into the concept of…

Q: The theory endosymbiosis is important in understanding how mitochondria and eukaryotic cells may…

A: Lynn Margulis propounded the endosymbiotic theory. According to this theory eukaryotic cells…

Q: Hemoglobin returning to the lungs will aid in vasodilation in response to: Group of answer choices…

A: Hemoglobin, Oxygen, CO2, and Vasodilation: A Detailed ExplanationHemoglobin's Role:Hemoglobin, the…

Q: Herophilus from Chalcedon identified how many chambers in the human heart? 6 chambers: the right…

A: The question is asking about the number of chambers in the human heart that were identified by…

Q: Which is NOT a common characteristic of mammals? A) have small brains compared to skull size B) have…

A: The question is asking us to identify the statement that is not a common characteristic of mammals.…

Q: The so-called "Age of Discovery" during the 1400s-1700s when the superiority of European cultures…

A: The question is asking whether it is true or false that the 'Age of Discovery', a period from the…

Q: Which of the following religious doctrines was not considered to be a heresy by the Council of…

A: The objective of the question is to identify which of the given religious doctrines was not…

Q: Practice Problems: 1. You have been tasked to estimate the number of rattlesnakes using a series of…

A: 1. 64 rattlesnakes2. λ between 2017 and 2018: Population 2018/2017=64/70≈0.9143λ between 2018 and…

Q: It is the holidays and you have just finished eating a large meal with your family. Now, you retire…

A: The parasympathetic nervous system (PSNS) and enteric nervous system (ENS) and their roles in…

Q: According to the morphological classification of anemias, megaloblastic anemia is a: Question…

A: The objective of the question is to identify the correct morphological classification of…

Q: Which type of cytoskeletal element is characterized as a hollow, rigid cylindrical tube with walls…

A: The question is asking to identify the type of cytoskeletal element that is described as a hollow,…

Q: Genetics Question 9

A: The objective of the question is to determine whether a mutation in an enhancer that prevents the…

Q: Microbial communities and Coral Reef restoration .Indicate the type of research you will be…

A: The objective of this question is to design a research plan for studying the relationship between…

Q: The factors contributing to the prevalence of Type 2 diabetes among Jamaicans

A: The objective of the question is to identify and explain the factors that contribute to the high…

Q: Question 2

A: The objective of the question is to understand the results of an experiment involving mice and two…

Q: O= I Н HY " H OH ...OH A hormone with the structure shown above would be lipid-soluble water-soluble

A: LIPID-SOLUBLEExplanation:Detailed explanation: The structure shown is a CORTISONE.It is a…

Q: 5. Based on your understanding of allosteric regulation and using terminology related to the…

A: Glycogen phosphorylase is a key chemical involved in glycogenolysis, the breakdown of glycogen into…

Q: A eukaryotic gene has two introns and three exons. The first intron closest to the promoter is 157…

A: To draw the structure of the hybridized mRNA and estimate the size of the protein coded for by this…

Q: You are running your first ELISA and make some mistakes. What would happen if each of the following…

A: The objective of the question is to understand the impact of various mistakes that can occur during…

Q: 6. In cats, short hair, tabby, and normal (no colorpoint) are dominant traits. Long hair, no…

A: Short hair (S) and Long hair (s)Tabby (T) and no stripes (t)Normal (N, no color point) and…

Q: 9. The Pitx1 protein has important functions in various tissues during stickleback development. The…

A: Pitx1 may be a gene that encodes a protein involved in the development of different tissues in the…

Q: Compare 1. Size (in basepairs) 2. Shape (linear or circular) 3. Copy number 4. Number of genes 5.…

A: The genomes we encounter can be categorized into three main types: the nuclear genome, mitochondrial…

Q: Subject: Environmental Physiology True or false: Urine dilution by the loop of Henle is dependent on…

A: FalseExplanation:The loop of Henle plays a crucial role in urine concentration and dilution in the…

Q: Which of the below would best be described as a metapopulation? Killer whales are predicted to…

A: Populations of a species that are geographically distinct yet linked by sporadic migration or…

Q: 2. Given the results table below, create a flow chart to differentiate the organisms so you could…

A: Here's a flow chart to differentiate the organisms based on the provided results table:graph TD;…

Q: easec many age ea Omm mm). d

A: Homozygote mutants refer to individuals who have two copies of a particular gene, and both copies…

Q: Which plant-based milk alternative has the highest level of saturated fats? Does it havemore…

A: Coconut Milk UnsweetenedExplanation:Introduction:In the realm of plant-based milk alternatives,…

Q: Subject: Environmental Physiology Explain how the differences in the thermal characteristics of…

A: The objective of this question is to understand the impact of thermal characteristics of terrestrial…

Q: QUESTION 15 The researchers Hershey and Chase conducted an experiment where they radioactively…

A: Solution is given below Explanation:In the experiment by Hershey and Chase:Protein Labeling (with…

Q: #. What is the purpose of the respiratory system? Answer plz!

A: Respiratory system can be divided into two parts conducting part and respiratory part. Conducting…

Q: A COVID treatment combination is Paxlovid: nirmatrelvir and ritonavir. The purpose of ritonavir in…

A: Paxlovid is a co-formulated medication containing two drugs: nirmatrelvir and ritonavir. While…

Q: i need actual data reported in any literature about timothy syndrome please

A: For actual data on Timothy syndrome, the key findings from the foundational literature and…

Q: (please correct answer and correct and incorrect option explain) For autosomal dominant disease with…

A: Autosomal dominant diseases with inadequate penetrance present a challenge in clinical genetics. In…

Q: Is there a single test that can reliably determine a person’s biological sex?

A: The objective of the question is to understand if there is a single, reliable test that can…

Q: Name the three main loopsof the hydrologic cycle. Then, describe how each of the three main loops…

A: The objective of the question is to identify the three main loops of the hydrologic cycle and…

Q: 3. Module 1. Ecomorobe a. Observe the morphologies of the eight different lizard species. For now,…

A: a. You observe eight lizards, four from each of two islands. Since you lack prior knowledge of their…

Q: in considering the interaction of multiple genes involved in complex traits and interaction with the…

A: The organism's genotype represents the specific set of genes that it carries. These genes are…

Q: Q1: Draw the distribution of a continuous trait like dorsal fin length with a mean fin length of…

A: Definition: Polygenic inheritance is a type of inheritance pattern where a trait is influenced by…

Q: What is the validity of concern for potential marine extinction? Defend these concerns or lack…

A: Concern for potential marine extinction is undeniably valid given the multitude of threats…

Q: How common is parasite-driven host extinction? Why does it occur with this frequency given what you…

A: The answer is given below. If you have any further queries or needed extra information in the…

Q: a) Let's say the two motif hits (CCACGAG and CCGCCAG respectively) turn out to be evolutionarily…

A: Motifs are mainly short, conserved sequence patterns that are associated with specific function of a…

Concept explainers

Microbial Growth

The development of microbial growth is influenced by various natural conditions (both physical and synthetic) like pH, temperature, saltiness, gas focus (O2, CO2, and H2), nutrients, water action, and assimilation. Knowing the distinctive physical and chemical factors that influence the development and endurance of microbial growth in the climate will assist with reinforcing endeavors outfitted towards their control. These lines lessen or diminish their harmful impacts on humankind, creatures, and the climate.

Question

Put the following Penicillium sp. structures in order from nearest to the Sab agar block (1) to furthest from the Sab agar block (4).

Septate Hypha

Conidiophore

Sterigma

Conidiospores

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1: Explaining about Penicillium

VIEW

Step 2: Explaining distance of various structures in Penicillium species from agar block

VIEW

Solution

VIEW

Step by step

Solved in 3 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

What culture medium can be used for the acclimatization of Bacillus and Pseudimonas to degrade phenol? It must be a nutrient-poor growing medium.
Describe the colony morphology if Neisseria Gonorrhoeae if it is grown in agar plates in the laboratory
The following image is of Stemonitis slime mold viewed at 100x magnification. Label all visible structures, and if possible, describe the functions.
Matching type. Match the items in column A with that in column B. Column B A. Physarum B. Aspergillus Column A 1.conidiospores 2. apothecia 3. plasmodium 4. basidiospores 5. quill wort C. Lycoperdon D. Dictyostelium E. Polypodium 6. sunflower F. Caryophillids 7. coconut palm G. Allomyces 8. magnoliids H. Pelomyxa I. Liliales 9. spike moss 10. prothallus J. Rhizopus 11. maiden hair tree K. Isoetes 12. isidia/soredia L. Pezizza 13. orchids M. Ranunculales 14. arbuscular mycorhizae N. Rosids 15. amitochondriate O. Persea americana (avocado tree) P. Commelinids Q. Ginkgo R. Selaginella S. Asterids T. Glomeromycota U. lichen
What is the type of sexual spore (Ascospore or Basidiospore) in: 1. Schizosaccharomyces pombe 2. Rhodotorula rubra 3. Pichia fermentans (if the sexual spore is not present, write N/A)
Clostridium Botulinum Physical caracteristics Shape Arrangement Gram status? Acid fast ? Capsule? Produce Endospore? Environmental Condition required for the growth Oxygen Which of these is: Obligate aerobe, obligate anaerobe, facultative anaerobe. Temperature Which of these is: Psychrophile, Mesophile, Thermophile pH Which of these is: Acidophile, Neutralophile, Alkaliphile
A microbiologist identifies a bacterium that is capable of degrading cellulose, lignin, chitin, latex, aromatic chemicals, and keratin. It produces metabolic byproducts that give soil a musty smell as well as some that can be used as antibiotics. Which of the following genera is being described? View Available Hint(s) for Part A Pseudomonas Campylobacter Neisseria Streptomyces
Why is Entamoeba histolytica often termed as clinically significant amoebic parasite
Why do yeasts generally have to be cultured for longer periods than most bacteria? Can bacteriological media be used for the cultivation of molds? Explain your answer. What is the difference between vegetative and aerial mycelia? What are the three classes of antifungal drugs based on their mechanism/site of action? Describe the mode of action of each class. Name one fungal virulence factors that promote fungal colonization. Explain the mechanism. Name one fungal virulence factors that damage the host. Explain the mechanism.
Which of the following bacterial genera is useful for the degradation of environmental pollutants? Streptomyces Nocardia Actinomyces Corynebacterium Rhizobium
What stucture of Bacillus anthracis makes it capable of surviving in powered form and natural soil, for indefinite periods of time.
The agent of gas gangrene is classified as an based on its oxygen sensitivity so in addition to antibiotics and debrideent, hyperbaric oxygen is commonly used in the treatment of gas gangrene. This organism can persist in the outside environment under extreme harsh conditions which include the presence of high levels of atmospheric oxygen because it is able to form an (seen as the absence of color in the Gram stain) which will germinate when introduced into environments such as deep muscle tissue with minimal levels of oxygen, lots of water, and lots of nutrients.