Submit a drawing of the following phospholipid: -x-group is phosphoserine (use google if you need to) -C1 tail is C18:0 -C2 tail is C20:2n-3 Draw at physiological pH, and with correct bond angles.
Q: To get all of the amino acids out of the oligopeptide below and into the bloodstream through the…
A: Oligopeptide: Any of the enzymes in the family of proteolytic enzymes, commonly known as proteases,…
Q: Dehydrogenase reactions in TCA cycle
A: Cellular respiration is a collection of three metabolic pathways that generate ATP by oxidation of…
Q: Why do some starch products set as they cool?
A: Introduction Starch is a carbohydrate which is commonly found in nature like wheat, rice, potatoes…
Q: The smooth endoplasmic reticulum can be described in what ways? Select the correct response(s): It…
A: The endoplasmic reticulum is composed of a network of flattened sacs and branching tubules that…
Q: d) Ninhydrin is used to turn amino acids in fingerprints purple, make a good way to stain…
A: Note: As per the guidelines, only the first two subparts are to be answered. Kindly resubmit the…
Q: The first reaction in glycolysis is the phosphorylation of glucose to form glucose 6-phosphate: P: +…
A: Given Values: ∆G°=13.8 kJ/mol or 13800 J/mol[Pi] = 5 mM[Glucose] = 5 mM
Q: See the oligopeptide below. Compare the quantities of high energy molecules (e.g. ATP/ADP/AMP,…
A: Oligopeptides: It contains from two to twenty amino acids and may be made up of dipeptides,…
Q: 10. The final electron acceptor in the electron transport chain is Complex IV. T F
A: The final stage of aerobic respiration is the electron transport chain (ETC), which is also the sole…
Q: 1x GGCGAUGGGCAAUAAACCGGGCCAGUAAGC Identify the start codon, and determine the complete amino acid…
A: Translation is the process of synthesis of proteins from mRNA. Proteins are synthesized by adding…
Q: The activity of an enzyme can be regulated by a: A) competitive inhibitor binding to the active…
A: The enzymes increase the rate of biochemical reactions and can be regulated by binding to…
Q: Under aerobic conditions of high ratios of NADH/NAD+ and ATP/ADP, as pyruvate is utilized for its…
A: Glycolysis: The process through which glucose is broken down to create pyruvate in a cell's…
Q: Which carbohydrate test can you use to distinguish a monosaccharide from a disaccharide? hexoses…
A: A carbohydrate is a biomolecule which consists of carbon, hydrogen and oxygen atoms. The hydrogen…
Q: 3. (a) The beakers below represent different conditions for measuring the initial velocity (vo) of…
A: Parameters such as Km and Vmax are used for comparing enzyme activities. If we know the initial rate…
Q: All enzymes have an optimal temperature and pH environment. Choose how the following changes might…
A: Enzymes are high molecular-weight protein molecules that catalyse biochemical reactions. The…
Q: Question 11 of 25 Among the given statements, which are characteristics of plant cells? Select the…
A: Osmosis is the process of net movement of water across a semipermeable membrane This transport…
Q: Discuss how to determine the elements of proteins and its reactions.
A: Proteins are the most abundant biomacromolecule of life. Proteins are primarily polypeptide…
Q: Use the data below to answer the following question: How much more energy is stored in a gram of fat…
A: A heterogeneous class of substances with comparatively similar physical characteristics are referred…
Q: 1. What color change do you observe in Part B of the experiment? In which of the test tubes did…
A: Proteins are made up of amino acid residues linked via a peptide bond. A peptide bond between two…
Q: Given 2 M Tris, pH 7.1 (pKa 8.0), 5 M NaOH, 5 M HCI, and water; how would you prepare 2 L of 0.2 M…
A: Equation of dilution: M1V1 = M2V2 where: M1 is the molar concentration of the stock solution. M2 is…
Q: 5. State whether the following statements are True or False, If False, explain why 5.1 Oxaloacetate…
A: 1. Oxaloacetate is formed by the oxidation of L-malate - Oxaloacetate is formed via oxidation of…
Q: 4. Transketolase transketolase requires a lysine in the active site while requires the cofactor TPP.
A: Transketolase is an enzyme that connects the pentose phosphate pathway to glycolysis. This enzyme is…
Q: 1. The peptide below was isolated from fermented milk and shown to have antioxidant properties…
A: Peptide is polymer of amino acids linked by peptide/amide (covalent) bond with release of a water…
Q: Although phosphoesters are generally not energetic enough to donate the phosphate to make a high…
A: For an energetically favorable reaction, the change in free energy will be negative, and for an…
Q: 10. Which of the following statements regarding insulin is false? A. Insulin is a signal that…
A: When blood glucose concentration increases or decreases, carbohydrate metabolism is coordinated by…
Q: 5) Both DNA polymerase (any DNA polymerase) and ligase catalyze the formation of a bond between…
A: DNA Polymerase and Ligase are the two classes of enzymes that take part in DNA replication and…
Q: Using an arrow, draw the site of cleavage for the following peptides that are reacted by: Pepsin…
A: Amino acids are building blocks of peptides and polypeptide chain. Peptides are consist of 2-50…
Q: 384 Hemoglobin: Allostery and Evolution Q5.1 - 2,3-BPG is a negative allosteric regulator of…
A: Hemoglobin (Hb) is a protein that is found in red blood cells. A specific protein called haemoglobin…
Q: In the corn snake Pantherophis guttatus, there are several different color variants, including…
A: Introns are non-coding sequences and exons are coding sequences in the gene. Splicing is the process…
Q: 1. Inulin is a polysaccharide composed of entirely fructose units. Which test should be used to best…
A: Introduction : Inulin - Inulin is a type of naturally occuring polysaccharide which is produced by…
Q: Concerning the citric acid cycle (TCA cycle), which of the following statements is false? The TCA…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP by the oxidation…
Q: 2. Biuret Test Color of 3% CuSO4 solution: Sample casein alanine albumin gelatin distilled water 3.…
A: Proteins are large molecules made up of amino acid residues linked via a peptide bond. Amino Acids…
Q: 1.0 E oxygen saturation (Y) 0.6 0.4 0.2 0.0 20 40 60 blood pO₂ (torr) 80 100 120 for this picture…
A: Hemoglobin carries oxygen from the lungs to the tissues and CO2 from the tissues to the lungs. When…
Q: In the free energy diagram below, molecule A (with energy x) is converted to molecule B (with energy…
A: Activation energy for a reaction is the minimum amount of extra energy that is necessary for the…
Q: In glycatysis, conversion of a molecule, of glucose, into 2 Molecules of Pyryvate, results in a net…
A: Glycolysis is the process of conversion of one molecule of glucose to two molecules of pyruvate. A…
Q: Q6.1: Three critical features of enzyme structure and function contribute to the overall efficiency…
A: The enzymes are biological catalysts that increases the rate of biochemical reactions. The enzymes…
Q: What is acid-base homeostasis?
A: Homeostasis is the ability of an organism to regulate its internal environment in varying external…
Q: discuss the biochemistry behind disorders related to aromatic amino acids with the aid of an…
A: Metabolic disorders are caused due to abnormalities in one or more processes in a metabolic pathway.…
Q: A D. J B с
A: Reactions can proceed forward or reverse reactions can proceed spontaneously without the help of…
Q: Are there any negative allosteric regulators for glycogen phosphorylase?
A: Glycogenolysis is a process of breakdown of glycogen. Glycogen phosphorylase is an enzyme that…
Q: Starch 1/2 English Muffin Fruit1 medium orange Milk 1 cup low-fat milk - Starch 1/2 c. Corn Protein-…
A: INTRODUCTION : Carbohydrates - Carbohydrates, or carbs(short name), are sugar molecules. Along with…
Q: In the article the authors reference the canonical forces in protein folding. Describe how these…
A: As per the central dogma of molecular biology, the DNA contain the information needed to synthesize…
Q: Identify the components of animal fatty acid synthase (FAS). acyl-CoA dehydrogenase B-ketoacyl…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: write the mechanism for the reaction of CO2 and the amino terminal of the alpha-1 chain of…
A: Hemoglobin is a multimeric protein that transports oxygen and CO2 in the body. A hemoglobin molecule…
Q: Will weighs 80 kg and his plasma osmolarity is 280 mOsm/L. He eats a salty snack containing 250 mM…
A: Plasma Osmolarity: The number of solute particles per 1 L of solvent is referred to as osmolarity.…
Q: A Biuret test is a chemical test used to determine the presence of a peptide bond in a substance.…
A: The biuret test detects the presence of proteins in a sample solution. The copper ions in the biuret…
Q: Question 1 Which of the following conditions would fail to produce a triacylglycerol? Group of…
A: Triacylglycerol : A triglyceride or triacylglycerol (TG) molecule is made up of a glycerol as…
Q: 2. What is the total yield from one molecule of glucose to two molecules of L-malate? A. 2 ATP/GTP,…
A: Glucose is converted to L-malate via the following pathway: 1. Glycolysis: 1 glucose is converted to…
Q: Η Η Η Η Η ΤΙΤΙΤ H-C-C-C-CC-G | | | | | Η Η Η Η Η I ОН
A: A functional groups are is a group of atoms that bonds within a molecule and is responsible for the…
Q: Calculate the resulting equilibrium concentrations of all four species. Express your answers to four…
A: In a general reaction such as: aA + bB ⇌ cC + dD At equilibrium, the concentration of reactants and…
Q: Which of the following enzymes requires Mg2+ to carry out its function? Alcohol dehydrogenase.…
A: An enzyme draws substrates to its active site, catalyzes the chemical reaction that creates the…
Step by step
Solved in 2 steps with 1 images
- A group of BS Biology students were tasked to design and fabricate different synthetic cell membranes that could be used to simulate cellular activities of certain organisms. Below are the chemical structures of the compounds that are available to them: H2C-OH НС — ОН HO H2C-OH myristic acid glycerol НО alpha-linolenic acid HO-P-o OH orthophosphate HO NH2 sphingosine OH CH2OH NH3 CH2OH HO ethanolamine HO OH OH OH Но. lactose ("point of attachment) Given these compounds, help the students assemble the structure of the lipid constituent for the cell membrane appropriate to study the following. Briefly explain your answer. (Draw the structure) а. a thermophilic bacteria thriving in a hot spring b. a hepatocyte of a sea lion in the Arctic Ocean С. a frog neurocyteThe following is a block diagram for a glycerophospholipid where the building blocks are labeled with letters and the linkages between building blocks are labeled with numbers. ____________ 5. Which building blocks are glycerol residues? ____________ 6. Which building blocks are phosphate residues? ____________ 7. Which linkages involve an alcohol residue? ____________ 8. Which linkages involve both glycerol and fatty acid residues?Electrophoresis is the movement of molecules within a matrix (paper, gel) to which an electric field is applied – from a central origin, a molecule with a net positive charge moves toward the negative pole (often called cathode) and a molecule with a net negative charge moves toward the positive pole (often called anode). for the pentapeptide: N – Lys - gly - asp - his - glu - C What is the net charge at pH 3? 2.What is the net charge at pH 11? 3. At pH 3 will the pentapeptide move to the negative pole, positive pole or not move? 4. At pH 11, the same question.
- Give the force of interaction involved in the protein folding of the protein structure A and C: COO CH,C-N-H• • •0- Pleated sheet structure A H C Helical structure CH3 CH3 - CH3 -CHCH,CH, CH- CH, CH3 (CH,),NH, -0-CCH,- C=0..•HN CH, CH, CH,CH CH,CH CH, CH, CH OH 0=C -CH,-S,S-CH,- H,Ñ Structure A: H-bonding: Structure C: Van der Waals O Structure A: Covalent interaction; Structure C: dipole-dipole interaction O Structure A: Salt bridge: Structure C: H-bonding Structure A: Hydrophobic interaction; Structure C: ionic interaction 00000 BConsider the following molecules. (a) Name the molecule and its function for letters: A, C, and E. (b) Name the group and where it is made in the cell for letters: B, C, and D. но H O H O H-N-C-C-N-C-C-N-C-C-OH H CH2 H OH H SH HHHHHHHHHHHHHH H H-C-0 பெ HHHH HHH H HHHHH HHH HHHH -C-C-C-C-C-C-C-C (-C-C-C-C-H H-C-0 OH H 130 HHHHHH HHHH HH HH H C-C-C-C-C-C-(-C-C-C-(-C-C-C-"-H H-C-0 D H. C E.Two different membrane components are shown in the figure below. HO B A CH3 choline head group C glycerol backbone H3C D hydrocarbon tail CH3 CH3 CH3 B- C- D CH₂ 0 CH3 O CH3 C=O C=O CH-CH₂ What are the molecular modules indicated by the letters A-D? Select from the two options provided for each module. Asterol polar head group CH₂ CH₂ O CH3
- What would the net charge be of a polypeptide with the sequence M-D-R-N-Q-K at pH 8? hint ionizable groups include N-terminus (pKa = 9.0), D (pKa = 3.9), R (pKa = 12.5), K (pKa = %3D %3D %3D %3D 10.5) O +2 O+1 O-1 00H онн C-C-N -C C-N OH +H20 HH H. H N- C-N-C-C OH OH H. R R The chemical reaction illustrated in the accompanying figure H H C-N-C-C OH N- -C OH R R The chemical reaction illustrated in the accompanying figure O links two monomers to form a polymer separates two phospholipids in a bilayer breaks a peptide bond is a hydrolysis reaction in a polysaccharide A piece of DNA has the following sequence: 5' TCATGG 3'. What would be the sequence of the complementary strand? O 3'AGTACC 5' O S' AGTACC 3 O3 CCATGA 5 O s CCATGA 3 Refer to the accompanying figure. RNA at the beginning of the strands are shaded in lighter color. Identify th leading strand in this figure! O a O b HICIRConsider the following molecules. (a) Name the molecule and its function for letters: A, C, and E. (b) Name the group and where it is made in the cell for letters: B, C, and D. но но но I|I|| I || H-N-C-Č-N-C-C-N-c-C- OH H CH2 H ÓH H SH A B HH H H HHH HHH H HHH H C-C-C-C-C-C ннннн нннн нннннн HH HHH -с-с-ҫ-ҫ--с-с-н H-C-o CH OH HH H H HH H H H H OH H H-C-0 H H HH H H H H Η Η Η Η HH HH HHHHHHHHH HH HO -C-C-C-C-C -C-C-C-C-C-C-C-C-H H-C-0 end H H HH H H H H H H HHHHH D H 'end
- Draw the structure of histidylthreonine, a dipeptide made from histidine and threonine, as it would appear at physiological pH. Explanation Click and drag to start drawing a structure. Chock 0, X 0 :0 E AhmConsider the protein below: HO HỘ NH CH-OH CH Identify/Name the noncovalent interaction between groups in the following locations: ΣMatch lipid descriptions in column A with the phospholipid types in column B. H is attached to the phosphate group bound to C3 of glycerol backbone An amino acid is attached to the phosphate group bound to C3 of glycerol backbone A primary ammonium ion is found in its structure A quaternary ammonium ion is found in its structure A. phosphatidylethanolamine B. glycerophospholipid C. phosphatidylcholine D. phosphatidylserine