Supply the missing information DNA: 3' mRNA: anticodon: amino acids: TAC-CCG-TCG-GGG-CGT-ATA-ACT 5' DNA: mRNA: 5' AUG-CGA-GGC-CCU-UUA-UAA-CCC 3' codon: anticodon: amino acids:
Q: Make use of the table below in answering the questions asked: Amino acid pK₁ pK₂ PK3 Isoleucine 2.32…
A: The amino acids have ionizable groups in them. The ionic form of the amino acids/ proteins depends…
Q: The function of the Electron Transport Chain (ETC) in eukaryotic cells is to produce a proton…
A: In the electron transport chain (ETC), the electrons pass through four enzyme complexes, that…
Q: Draw the catalytic triad of a serine protease at the first tetrahedryl intermediate stage. Your…
A: Serine proteases cleaves peptide bonds of protein substrates. They are called serine proteases…
Q: What are the key differences between DNA synthesis (in the context of DNA replication) and RNA…
A: DNA is the genetic material. Replication is the process that copies the DNA to produce identical…
Q: is lapoamide involved in oxidation reduction..
A: INTRODUCTION : First of all there is no such proper biochemical name like Lapoamide(its incorrect)…
Q: Can I please get help? 1. Describe the morphological phenotypes you see in the experimental…
A: Neurons: Sending, receiving, and transmitting electrochemical impulses throughout the body is the…
Q: E mitochondria Question #: 25 While developing new inhibitors we came up with new compound, a…
A: Enzymes are high molecular weight protein that catalyse biochemical reactions. They contain a active…
Q: 1x GGCGAUGGGCAAUAAACCGGGCCAGUAAGC Identify the start codon, and determine the complete amino acid…
A: Translation is the process of synthesis of proteins from mRNA. Proteins are synthesized by adding…
Q: 3. DNA: TACGGGCCTATACGCTACTAC TCATGGATCGG mRNA: Codon: Anitcodon: Amino Acids:
A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…
Q: 13. Discuss the energetics of High energy molecules that carry phosphates and provide an example of…
A: Cellular metabolism is made possible due to the participation of high energy molecules. The purpose…
Q: xplain the indirect effect that allosteric effectors have on pyruvate dehydrogenase activity through…
A: The pyruvate dehydrogenase complex acts a a connection between glycolysis, the tricarboxylic acid…
Q: WHAT I CAN DO Activity 6: I learned something? Procedure: In your own understanding answer the…
A: Anaerobic A-lactic energy system: A third system generates ATP at a very high rate when quick,…
Q: Discuss the role (direct or indirect) of carbohydrates on cancer and Suggest an appropriate…
A: Carbohydrates, lipids, and proteins are the biomolecules that are required in large amounts by the…
Q: 1. Discuss how the pH and temperature affect the solubility of protein. 2. Explain "salting-in" in…
A: Proteins are large molecules made up of amino acid residues linked via a peptide bond. Amino Acids…
Q: It is being said that our bodies cannot produce lactic acid but rather lactate and it's the…
A: INTRODUCTION : Lactic acid & Lactate - To understand the difference we have to look at their…
Q: The following are true of the mitochondrial structure I. The inner mitochondrial membrane is…
A: Mitochondria are power house of cell, known to synthesize ATP. They are membrane bound organelles…
Q: PEP and 2-PG have similar amounts of potential metabolic energy with respect to decomposition to Pi,…
A: Glycolysis occurs in the cytoplasm of the cell. Glycolysis converts glucose into two molecules of…
Q: 13. Linear regression analysis was performed for the calibration standard data set based on this…
A: Concentration of any unknown sample can be found out from a standard curve. The standard curve is…
Q: Which coenzyme is NOT paired with its correct dietary precursor? thiamine → thiamine pyrophosphate…
A: Coenzymes are important in the metabolic pathways as they help enzymes in catalysing the reactions.…
Q: 1) Which of the following statement(s) regarding the ends of polysaccharides are true? All…
A: The biological macromolecules can be classified as proteins, nucleic acids, lipids and…
Q: Which of the following is correctly classified? O Arachidic (20:0) is a medium chain unsaturated…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons. The…
Q: True or False for each question ( ) Guanine, Adenine, Uracil, and Cytosine are commonly found…
A: The biological macromolecules are classified as nucleic acids, proteins, lipids and carbohydrates.…
Q: dideoxy sequencing
A: Identifying the precise order of nucleotides, or bases, in a DNA molecule is done using a standard…
Q: Will weighs 80 kg and his plasma osmolarity is 280 mOsm/L. He eats a salty snack containing 250 mM…
A: Plasma Osmolarity: The number of solute particles per 1 L of solvent is referred to as osmolarity.…
Q: What is the property/characteristics of DNA that makes it insoluble to ethanol/isopropyl alcohol?
A: The mechanical separation of the nuclear contents from the remainder of the cell, accomplished by…
Q: An uncompetitive inhibitor interacts with the enzyme•substrate complex to form a ternary complex…
A: Enzyme inhibition is a process by which the activity of an enzyme is altered. Inhibitors are…
Q: Kt of glucose for GLUT1=3 mM, GLUT2=17 mM, GLUT 3=1.3 mM, and GLUT11=0.3 mM. Sketch a graph with…
A: The equation that gives the rate of transport of molecule is similar to the rate equation of…
Q: What mechanism of RNA regulation is responsible for the two different forms of apolipoprotein B? O…
A: Apolipoprotein B is encoded in humans by APOB gene. It is the primary apolipoprotein of VLDL, LDL…
Q: What is the charge on the following peptide at standard biochemical pH? S-Y-D-F-K-I-V-F-L-L +2 -1 O…
A: Peptides are composed of amino acids. Amino acids are biomolecules with an alpha carbon bonded to an…
Q: As the leading scientist in a biomedical science laboratory, it is up to you to give advice to your…
A: Polymerase chain reaction or PCR s a method to obtained large number of copies of a target DNA…
Q: Sm When proteins are solubilized in inclusion bodies from an E Coli cell lysate, they are unfolded.…
A: Plasminogen is an important enzyme which is present in blood and degrades plama proteins like…
Q: See the oligopeptide below. Compare the quantities of high energy molecules (e.g. ATP/ADP/AMP,…
A: Oligopeptides: It contains from two to twenty amino acids and may be made up of dipeptides,…
Q: molecule with a hydrophilic end and a hydrophobic end
A: Molecules with a hydrophobic and hydrophilic end are known as amphipathic molecules. Such molecules…
Q: Make use of the table below in answering the questions asked: Amino acid pK₁ PK₂ pK3 2.32 9.76 2.32…
A: Isoelectric point is the ph at which the peptide carries a net charge of 0. The proteins are least…
Q: Many proteins that remain homogeneously distributed in water have molecular masses in the range of…
A: A colloid is a heterogeneous mixture in which the dispersed particles are intermediate in size…
Q: Submit a drawing of the following phospholipid: -x-group is phosphoserine (use google if you need…
A: Glycerophospholipids or phospholipids are lipids found in the biological membrane. In phospholipids,…
Q: is it true that aplha and beta are made up of same amino acids but Beta chain is longer than alpha…
A: Hemoglobin (Hb) is a complex protein which is consist of two parts - the heme and the globin. Heme…
Q: What are the components of a nucleotide? Provide 1- or 2-sentence description of each component.
A: Nucleic acids are biomolecules that are essential for all life forms. They are polymers of…
Q: For each of the structures listed below identify the class of lipids to which it belongs (fatty acid…
A: Lipids are biomolecules that do not have a fixed chemical structure like carbohydrates or amino…
Q: 4. Below each item, identify WHAT it is, indicate WHERE in the cell it is used/made (cytoplasm or…
A: Glycolysis is the metabolic pathway that converts glucose into pyruvate. The free energy that is…
Q: Describe the signal transduction pathway for Two or Three of the following: a) ß-adrenergic…
A: Beta adrenergic receptor is a G-protein-coupled receptor communicating through the Gs alpha…
Q: Fill in this table for cortisol, aldosterone, testosterone, estradiol, parathyroid gland hormone,…
A: Hormones are chemical messenger or signaling molecules present in our body which travel in our…
Q: Chemistry When the steady-state concentration of a drug on one side of the membrane is 5 micromolar…
A: According to Fick's first law, dC/dt= K(C1-C2)/h
Q: receptor/s b. the energy source c. if there is signal peptide cleavage or none E. Mitochondrion…
A: Major proportion of the mitochondrial proteins are encoded by the nuclear genes. These proteins are…
Q: Which sequencing project(s) would be done better using a next generation method (like Illumina)…
A: Sanger sequencing method - it is also known as chain termination method of gene sequencing. This…
Q: Briefly explain the Warburg Effect. How can the Warburg effect be taken advantage of (HINT: make…
A: INTRODUCTION : Glycolysis : It is a metabolic pathway of the cells of body, in which Glucose is…
Q: Amino acid analysis of a HEPTAPEPTIDE reveals the following information below: (NOTE: when the…
A: The proteins are composed of sequence of amino acids connected via peptide bonds. The sequence of…
Q: 1. Why do proteins become polycations at extremely low pH and become polyanions at very high pH? 2.…
A: Proteins are biological macromolecules formed by monomers of amino acids. The amino acids have side…
Q: What is DNA? Provide a 5-sentence long description only.
A: Nucleic acids, large macromolecules are necessary for all organisms and viruses to function. The…
Q: Please help with 2a) 2a) There are two different DNA polymerase enzymes, DNA Polymerase I and DNA…
A: Replication is the process of duplication of two strands of a double stranded DNA. In bacteria, the…
Step by step
Solved in 2 steps
- Give the RNA molecule sequence transcribed from the following DNA sequence of a eukaryotic gene and with the correct 5' and 3' ends. DNA: 5'-ATAGGGCATGT-3' 3'-TATCCCGTACA-5' <--- template strand Group of answer choices 5'-ATAGGGCATGT-3' 3'-UAUCCCGUACA-5' 5'-AUAGGGCAUGU-3' 3'-TATCCCGTACA-5'Answer the following: DNA fragment A is 3' AGC CCG CTC CGA GGC TAA AAG CGT 5' 1. is % of guanine in DNA fragment A 2. is the 4th codon in the complement of DNA fragment A from the 5' end 3. is the 3rd codon in the mRNA copied from DNA fragment A from the 3' end 4. is the N-terminal amino acid of the peptide produced 5. is the C-terminal amino acid of the peptide producedTranslate the RNA codons using the given genetic code 5' A-U-C-G-A-C-G-A-U-C-C-G-A-U-C-G-A-U 3'
- Give the complementary codons, anticodons, and amino acids for the following: - ATG - CCA-AGG-GCT - ACT Code: TAC-TCG-CGC-ACC-GTA-TGC Give the complementary code, anticodons, and amino acids for the following: Codon: AUG - UCA - UCU - CGU - UAC - CCU - GCC-ACU-GCA - CUG - UAG Give the complementary code, codons, and amino acids for the following: Anticodon : UAC – CUA – GAC – AUG – GGG – CAU – UGG – CCA – GCA – AUU Complete the following tables: CODE: T-A-C A-T-G C-C-G T-G-G A-A-T C-G-C A-T-T CODON: ANTICODON: AMINO ACID: CODE: CODON: ANTICODON: U-A-C A-U-G U-U-C C-G-A AMINO ACID: CODE: CODON: A-U-G ANTICODON AMINO ACID: T-T-A C-C-U A-U-C A-U-C C-C-U A-C-U C-U-G T-A-C U-A-GThe DNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using this sequence, write the sequence of the polypeptide that results from this gene. Be sure to appropriately label the ends of the molecule. 5'-ATGCACGGCGACTAG-3' Second letter A UAU Tyr UAC First letter U A G U UUU1 UUC UUA LOU Leu CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu AUU AUC lle AUA AUG Met Val C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala CAU His CAC CAA CAG Gin AAU Asn AAC AAA 1 Lys AAG LYS G {}a UAA Stop UGA Stop A UAG Stop UGG Trp GAU 1 GAC Asp GAA GIU Glu GAGJ UGU UGC CGU CGC CGA CGG AGU AGC AGA AGG Cys GGU GGC GGA GGG Arg Ser Arg DOA DOA DOA DUTO Third letter GlyWrite the amino acid for the codons below 5'-AUG UUC CAG CUA GAU GAU AUG CUG GUA AUU GGG GAA CGC GCG CGG UAA-3'
- A protein uses a gene template in 3' to 5' direction. What are the amino acid sequences following this DNA chain? 5'-ATGTCGACAGCCTAA-3' First Second Letter Third Letter U A G Letter phenylalanine serine tyrosine cysteine U phenylalanine serine tyrosine cysteine U leucine serine stop stop A tryptophan arginine arginine leucine serine stop leucine proline histidine U leucine proline histidine leucine proline glutamine arginine A leucine proline glutamine arginine G isoleucine threonine asparagine serine U isoleucine threonine asparagine serine A isoleucine threonine lysine arginine A methionine threonine lysine arginine G valine alanine aspartate glycine U valine alanine aspartate glycine G valine alanine glutamate glycine A valine alanine glutamate glycine G O Met-lle-Thr-Ala-STOP O Met-Ser-Thr-Ala-STOP Met-Ser-Trp-Arg-STOP Met-Tyr-Thr-Arg-STOPThe partial sequence of a gene Question 2 coding strand is: 5'-TACGATCATAT-3. This sequence is transcribed. What is the sequence of the corresponding RNA? A 5'-UACGAUCAUAU-3’ B 5'-ATATGATCGTA -3’ C 5'-AUGCUAGUAUA-3’ D 5'-AUAUGAUCGUA-5’ E 5'-TATACTAGCAT-3’A protein uses a gene template in 3' to 5' direction. What are the amino acid sequences following this DNA chain? 5'-ATGTCGACAGCCTAA-3' First Second Letter Third Letter Letter phenylalanine phenylalanine serine tyrosine tyrosine cysteine cysteine U serine leucine serine stop stop A leucine serine stop tryptophan arginine G leucine proline histidine leucine proline histidine arginine leucine proline glutamine arginine arginine A leucine proline glutamine isoleucine threonine asparagine asparagine lysine serine isoleucine threonine serine A isoleucine threonine arginine methionine threonine lysine aspartate arginine valine alanine glycine glycine valine alanine aspartate C G valine alanine glutamate glycine glycine A valine alanine glutamate O Met-lle-Thr-Ala-STOP O Met-Ser-Trp-Arg-STOP O Met-Tyr-Thr-Arg-STOP O Met-Ser-Thr-Ala-STOP
- 4 sports = Gly, Val 8 legs = Val, His, Ille, Tyr Straight antennae = Ala, lle, lle Start codon = AUG Stop codon = UGA / UAA / UAG For the insect to have 4 spots, 8 legs and straight antennae what would the non-template DNA be (don't worry about the introns)? Tip: Don't forget the start and stop codons. Note: Please depict all possible RNA/DNA alternatives for the amino acids as shown below GLY = GG A G 3' Protein 5' 3' RNA 5' 3' DNA 5'Transcribe the given DNA sequences to mRNA. DNA: 5'-GATCCGC-3' DNA: 5'-TTACGCTAA-3' DNA: 5'-ACGTCAATGGA-3' DNA: 5'-GCGCGGATTAGCGAT-3' mRNA: 3'- mRNA: 3'- mRNA: 3'- mRNA: 3'- -5' -5' -5' -5'The following sequence represents the dsDNA code for a short peptide 5' -CTT TCC CAT CAC CGC ATG CAT CCT CCC TCC TTT CTT TAA TAT TGG-3' 3'-GAA AGG GTA GTG GCG TAC GTA GGA GGG ACC AAA GAA ATT ATA ACC-5' Transcribe the DNA strand given above to write the sequence of the mRNA strand in the 5’ to 3’ direction. (1) Use the table and write the sequence of the resulting peptide. (1) Is it possible for a codon to code for another amino acid? (1) What will be the effect if a mutation changes the codon UAU to UAA? (1) What is a reading frame? (1) If you are given a nucleotide sequence, how would you find Open Reading Frames? (1) DISCUSS the reason why there are leading and lagging strands in replication?