Concept explainers
Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book.
A Simple Genome and Its Protein-Encoding Capacity The genome of the Mycoplasma genitalium consists of 523 genes, encoding 484 proteins, in just 5S0.U74 base pairs (see Table 1.6). What fraction of the M. genitalium genes encode proteins? What do you think the other genes encode? If the fraction of base pairs devoted to protein-coding genes is the same as the fraction of the total genes that they represent, what is tlie average number of base pairs per protein-coding gene? If it takes three base pairs to specify an amino acid in a protein, how many amino acids are found in the average M. genitalium protein? If each amino acid contributes, on average, 12U daltons to the mass of a protein, what is the mass of an average M. genitalium protein? (Section 1.5)
Trending nowThis is a popular solution!
Chapter 1 Solutions
Biochemistry
- Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. CRISPR/Cas9: Design of a gRNA to Target the Human PVALB Gene The human PVALB gene, which encodes the Ca2+-binding protein parvalbumin, can be Targeted by CRISPR/Cas9, at the protospacer sequence - ATGCAGGAGGGTGGCGAGAGGGGCCGAGAT- followed by a -TGG-PAM trinucleotide. Give the sequence of the spacer region of a gRNA that will target the complementary DNA strand at this site. Include at the 3'-end of your gRNA sequence a region that will form a stem-loop structure with a 5'-AGCAUAGCUGUAAAAC- sequence downstream in the gRNA to create the dsRNA-binding site for Cas9.arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Designing Primers for PCR Amplification of a DNA Sequence Given the following short DNA duplex of sequence (53)ATGCCGTAGTCGATCATTACGATAGCATAGCACAGGGATCCA- CATGCACACACATGACATAGGACAGATAGCAT what oligonucleotide primers (17-mers) would be required for PCR amplification of this duplex?arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Preparing cDNA Libraries from Different Cells Describe an experimental protocol for the preparation of to cDNA libraries, one from anaerobically grown yeast cells and the second from aerobically grown yeast cell.arrow_forward
- Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Calculate the Frequency of Occurrence of an RNAi Target Sequence The RNAs acting in RNAi are about 21 nucleotides long. To judge whether it is possible to uniquely target a particular gene with a RNA of this size, consider The following calculation: What is the expected frequency of occurrence of a specific 21-nucleotide sequence?arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. An Estimation of the Number of Cenes in a Virus Virus genomesrange in size from approximately nucleotides to approximately 280,000 base pairs. If viral genes are about the same size as M. genilalium genes, what is the minimum and maximum number of genes in viruses? (Section 1.5)arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. The Sequence Relationship Between an Antisense RNA Strand and Its Template DNA Strand The DNA strand that is complementary to the template strand copied by RNA polymerase during transcription has a nucleotide sequence identical to that of the RNA being synthesized (except T residues are found in the DNA strand at sites where U residues occur in the RNA). An RNA transcribed from this nontem-plate DNA strand would be complementary to the mRNA synthesized by RNA polymerase. Such an RNA is called antisense RNA because its base sequence is complementary to the “sense mRNA. One strategy to thwart the deleterious effects of genes activated in disease slates (such as cancer) is to generate antisense RNAs in affected cells. These antisense RNAs would form double-stranded hybrids with mRNAs transcribed from the activated genes and prevent their translation into protein. Suppose transcription of a cancer-activated gene yielded an mRNA whose sequence included the segment 5’-UACGUCUAAGCUGA. What is the corresponding nucleotide sequence (5’ The template strand in a DNA duplex that might be introduced into these cells so that an untisense RNA could be transcribed from it?arrow_forward
- Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Identifying DNA Structural and Functional Elements from Nucleotide Sequence Information Listed below are four DNA sequences. Which one contains a type-II restriction endonuclease (six-cutter) hexanucleotide site?. Which one is likely to form a cruciform structure? Which one is likely to be found in Z-DNA? Which one represents the 5'-end of a tRNA gene? Which one is most likely to be found in a triplex DNA structure? a. CGCGCGCCGCGCACGCGCTCGCGCGCCGC b. GAACGTCGTATTCCCGTACGACGTTC c. CAGGTCTCTCTCTCTCTCTCTC d. TGGTGCGAATTCTGTGGAT e. ATCGGAATTCATCGarrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Chargaff’s Rules for the Base Composition of DNA Chargaff’s results (Table 10.1) yielded a molar ratio of 1 1.29 for A to G in ox DNA, 1.43 for T to C, 1.04 for A to T, and 1.00 for G to C. Given these values, what are the approximate mole fractions of A. C, G. and T in ox DNA?arrow_forwardAnswers to all problems are at the end οΓthis book. Detailed solutions are available in the Student Solutions Manual. Study Guide, and Problems Book. Superbug infections are becoming more common around the world. Many of these infections arise from the action of -lactamases, of which there are several types with different mechanisms of action. Consult the end-of-chapter reference by von Nussbaum and Schiffer and write detailed mechanisms for the serine -lactamases and metallo- -lactamases.arrow_forward
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning