Concept explainers
Your bone cells, muscle cells, and skin cells look different because
- a. different kinds of genes are present in each kind of cell.
- b. they are present in different organs.
- c. different genes are active in each kind of cell.
- d. different mutations have occurred in each kind of cell.
Introduction:
Almost all the cells in an organism are genetically identical bit different types of cells looks different result from differential gene expression. Genes are expressed by turning on and turning off its expression as a result of interaction with regulatory proteins. Each cell type contains a unique set of proteins that regulates the gene expression by controlling different levels; transcriptional level, processing level and translational level.
Answer to Problem 1SQ
Correct answer:
Eukaryotic and multicellular organism regulates gene expression to maintain different cell types during embryonic development. Therefore option c. is correct.
Explanation of Solution
Reason for correct statement:
The control of gene expression makes it possible for cells to produce specific kind of proteins that make different type of cells with the organism even if their genetic composition is same.
Option c. is given as “different genes are active in each kind of cell”.
As, in eukaryotic organisms each cell maintain differential gene expression; the bone cells, muscles cells and skin cells looks different as the differential gene expression provide them with expression of different protein responsible for particular characters. It is the right answer.
Hence, option c. is correct.
Reasons for incorrect statements:
Option a. is given as “different kinds of genes are present in each kind of cell”.
As all the cells preset in an organism contain similar genetic composition and so have identical genes. So it is a wrong answer.
Option b. is given as “they are present in different organ”.
As, different cells responsible to provide different functions to organs by expressing different genes and organs, they are not responsible for cells diversity in the body. So it is a wrong answer.
Option d. is given as “different mutations have occurred in each kind of cells”.
As, mutation is responsible for altering the function in a gene present in the cell; it cannot be associated with diversity of cells present in the organism’s whole body. So it is a wrong answer.
Hence options a., b., and d. are incorrect.
The bone cell, muscles cells and skins cells look different as they control their gene expression by differential expression that different kind of proteins and provide them different structure and functions.
Want to see more full solutions like this?
Chapter 11 Solutions
Campbell Essential Biology with Physiology (6th Edition)
Additional Science Textbook Solutions
Biological Science (6th Edition)
Human Biology: Concepts and Current Issues
Biological Science
Human Biology: Concepts and Current Issues (8th Edition)
Microbiology: Principles and Explorations
- In the novel Chromosome 6, by Robin Cook, a biotechnology company genetically engineers individual bonobos (a type of chimpanzee) to serve as future organ donors for clients. The genes of the bonobos are altered so that no tissue rejection takes place when their organs are transplanted into a client. What genes would need to be altered for this scenario to work? Explain your answer.arrow_forwardYou are working in a lab that studies stickleback fish. These fish normally have three spines that occur on the back of the stickleback. One day you notice that a young stickleback has no spines on its back but instead has three spines growing out of the top of its head! (answer both questions) question 1: A mutation in what type of gene is probably the cause of this unusual situation? Why? question #2: would you expect the proteins that make the spines to be different in the mutant fish compared to a wildtype fish. Why or why not?arrow_forward5)What are the characteristics of stem cells? (Select ALL that apply) Select one or more: a. They have the potential to develop into different cell types. b. They have the ability to make more stem cells. c. They have the potential to develop into any cell type in the human body. d. When certain genes are turned on, stems cell undergo differentiation. e. Stem cells can divide indefinitelyarrow_forward
- Which of the following statements about genes is incorrect? Select one: O a. During fertilization, both the sperm and the ovum contribute genes to the resulting fertilized egg. b. Genetic differences can result from changes in the DNA called mutations. O c. Genes correspond to segments of DNA. d. Under normal circumstances, each chromosome contains precisely one gene. e. Many genes contain the information needed for cells to synthesize enzymes and other proteins.arrow_forwardA.) There is no change in the DNA sequence if nucleotides are added or removed, it will have no effect to the cell. B.) Mutations in the DNA sequence are all irreversible. A. Statement A is correct B. Statement B is correct C. Both A and B are correct D. Both A and B are incorrectarrow_forwardWhich of the following is NOT true about mutations? A. Mutations can be harmful but not beneficial to the cell B. Nucleotide substitution in DNA can cause nonsense mutations C. Nucleotide substitution in DNA can cause missense mutations D. Mutagens increase the rate of mutation, but mutations are still random E. Nucleotide insertion or deletion in DNA can cause frameshift mutationsarrow_forward
- 1a) Why is it possible for you to study the eye colour gene by extracting cheek cells? a. Because the nucleus of every cell in the human body contains the same genetic information. b. Because the cheek cells are located near the cells of the eye and so they are able to exchange DNA. c. Because all genes in the human body are expressed at all times so it is easy to study them. d. All of the above are possible explanations. 1b) What is the purpose of heating the sample to 75°C following addition of the 0.2M NaOH solution? a. To denature the histone proteins that are keeping the DNA tightly coiled. b. To ensure that all the DNA is removed from the swab in preparation for PCR. c. To breakdown the cheek cell membrane to release the DNA from the cell. d. It breaks down the circular DNA down into linear fragments so that they will be easier to visualize.iarrow_forwardSeveral large studies have shown that daily doses of aspirin protect against colon cancer. This type of study reinforces the link between ________________ and ____________ . (A) mutations, polyps (C) aspirin, stomach upset(B) cancer, diet (D) cancer, chronic inflammation immune check point inhibitors are ____________ which ______________. (A) chemicals, activate T cells (C) antibodies, activate T cells (B) chemo drugs, kill tumor cells directly (D) enzymes, break up tumors Increased colonoscopies has led to earlier detection of colon cancer. However, recent studies have shown that less expensive, lower-tech options like ___________ offer nearly the same screening benefit. (A) flexible sigmoidoscopy (C) CT scans(B) fecal occult stool testing (D) fecal DNA testing PSA testing and mammography have led to undertreatment. (A) True (B) Unclear (C) False The chromosomal location of the APC gene was originally identified by finding a region of the genome that was _________ in patients with…arrow_forwardAlthough it is well known that X-rays cause mutations, they are routinely used to diagnose medical problems, including potential tumors, broken bones, and dental cavities. Why is this done? What precautions need to be taken?arrow_forward
- With regard to human cancer cells, which of the following statements is true? A. Cancer cells within one tumor usually do not share common mutations B. Cancer cells generally have lost the ability to divide C. Oncogenes are non-human genes not related to normal genes in the human genome D. Mutations in DNA repair genes result in an increased chance of getting cancer.arrow_forwardGene expression is a term that relates to Select one: A. DNA replication. B. the flow of genetic information from DNA to proteins. C. how genes are passed from parent to offspring. D. the unique set of genes in an individual.arrow_forwardOf those in the following list, which organ(s)/tissue(s) is/are affected by mutations in this gene CAGATTGTGAAGAGGTCTCTTGA? select all that apply a. pancreas b. skin c. heart d. eyes e. spine and skeleton f. colonarrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning