Brock Biology of Microorganisms (15th Edition)
Brock Biology of Microorganisms (15th Edition)
15th Edition
ISBN: 9780134261928
Author: Michael T. Madigan, Kelly S. Bender, Daniel H. Buckley, W. Matthew Sattley, David A. Stahl
Publisher: PEARSON
bartleby

Videos

Textbook Question
Book Icon
Chapter 12, Problem 1AQ

Suppose you have just determined the DNA base sequence for an especially strong promoter In Escherichia coli and you are Interested in incorporating this sequence into an expression vector. Describe the steps you would use. What precautions are necessary to be sure that this promoter actually works as expected in its new location?

Expert Solution & Answer
Check Mark
Summary Introduction

To discuss:

The incorporation of the sequence of a strong promoter in E. coli into an expression vector. Steps and precautions required to evaluate the expression of the promoter in its new location.

Concept introduction:

An expression vector is a plasmid or virus and it used for gene expression. In gene expression, the gene of interest is inserted into the expression vector, which is used to carry the gene to the host. The gene encoding protein is produced in the host organism.

Explanation of Solution

  • The expression vector is used for high level gene expression of cloned genes (for example, eukaryotic genes) in prokaryotes.
  • The expression vector should contain an origin of replication, marker gene, and multiple cloning sites.
  • The promoter sequence must be incorporated into the expression vector.
  • The expression vector should contain restriction site, where the gene of interest is inserted.
  • It should help to synthesize the target protein molecule by producing the stable corresponding mRNA molecules. Therefore, strong promoter is required for binding of the RNA polymerase enzyme and that may lead to the high level of transcription.
  • The promoter should control and regulate the expression of the cloned gene, because more production of foreign protein molecules may disturb the host (E. coli) and it is considered as an important precaution. In addition, this vector should contain the transcription termination region for proper mRNA production. The promoter must contain an operator sequence in its upstream region and that provide RNA polymerase binding on the promoter region.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!
Students have asked these similar questions
Suppose you have just determined the DNA base sequence foran especially strong promoter in Escherichia coli and you areinterested in incorporating this sequence into an expressionvector. Describe the steps you would use. What precautionsare necessary to be sure that this promoter actually works asexpected in its new location?
Recombinant expression in prokaryotic systems has numerous advantages when compared to eukaryotic systems, one of which is the ability to produce the protein of interest at high levels. For this, it is essential to use strong promoters and genetically modified bacteria capable of overexpressing the exogenous gene. Therefore, mark the alternative that best represents the set of bacterial promoters/strains for protein overexpression. * A)use of the T7 promoter, whose induction occurs by the addition of IPTG in the culture medium, and use of the Escherichia coli strain BL21DE3. B)use of the T7 promoter, whose induction occurs by the addition of IPTG in the culture medium, and use of the Escherichia coli DH5 strain. C)use of the lac promoter, whose induction occurs by the addition of IPTG in the culture medium, and use of the Escherichia coli DH5 strain. D) use of the constitutive trp promoter, whose induction occurs by the addition of the amino acid Tryptophan in the medium, and use of…
The sequence of the lac promoter and two mutant promoters (Mutn 1 and Mutn 2) are shown below. The activity of these promoters is measured by fusing the them to the gene for Green Fluorescent Protein (GFP) and measuring the production of green fluorescence by GFP protein. What would you expect the GFP signal to be higher, lower or same for mutant promoters. Mutn 1 (enter higher, lower or same) Mutn 2 (enter higher, lower or same) - 42 ? ? +1 Lac CCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGA CCAGGCTTAAAACTTTATGCTTCCGGCTCGTATGTTGTGTGGA Lac Mutl Lac Mut 2 CCAGGCTTTACACTTTATGCTTCCGGCTCGTATAATGTGTGGA

Chapter 12 Solutions

Brock Biology of Microorganisms (15th Edition)

Ch. 12.3 - Prob. 3MQCh. 12.3 - Prob. 1CRCh. 12.4 - How can site-directed mutagenesis be useful to...Ch. 12.4 - What is used to alter more than a few base pairs...Ch. 12.4 - What are knockout mutations?Ch. 12.4 - What does site-directed mutagenesis allow you to...Ch. 12.5 - What is a reporter gene? The product of which...Ch. 12.5 - Prob. 2MQCh. 12.5 - Describe two widely used reporter genes.Ch. 12.6 - Prob. 1MQCh. 12.6 - Prob. 2MQCh. 12.6 - Prob. 3MQCh. 12.6 - Prob. 1CRCh. 12.7 - Prob. 1MQCh. 12.7 - Give an example of a genetically modified plant...Ch. 12.7 - How have transgenic salmon been engineered to...Ch. 12.7 - What is the Ti plasmid and how has it been of use...Ch. 12.8 - Explain why recombinant vaccines might be safer...Ch. 12.8 - Prob. 2MQCh. 12.8 - Prob. 3MQCh. 12.8 - What is a subunit vaccine and why are subunit...Ch. 12.9 - Explain why metagenomic cloning gives large...Ch. 12.9 - What types of environments are often sampled to...Ch. 12.9 - Prob. 3MQCh. 12.9 - How has metagenomics been used to find novel...Ch. 12.10 - How has Caldicellulosiruptor been modified to...Ch. 12.10 - Prob. 2MQCh. 12.10 - What has been the limiting factor in engineering...Ch. 12.10 - Prob. 1CRCh. 12.11 - What are biobricks?Ch. 12.11 - Prob. 2MQCh. 12.11 - How was Escherichia coli modified to produce a...Ch. 12.11 - Prob. 1CRCh. 12.12 - Prob. 1MQCh. 12.12 - Prob. 2MQCh. 12.12 - How is recombinant DNA inserted into a genome...Ch. 12.12 - How has the CRISPR editing technology been applied...Ch. 12.13 - Prob. 1MQCh. 12.13 - How can a tRNA be engineered to encode for a...Ch. 12.13 - Prob. 3MQCh. 12.13 - What are some mechanisms for controlling a...Ch. 12 - Suppose you have just determined the DNA base...Ch. 12 - Prob. 2AQCh. 12 - Prob. 3AQCh. 12 - Describe how you could recode Escherichia coli to...
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Text book image
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Text book image
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Text book image
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY