CASE STUDY | A drug that sometimes works
A 30-year-old woman with β-thalassemia, a recessively inherited genetic disorder caused by absence of the hemoglobin β chain, had been treated with blood transfusions since the age of 7. However, in spite of the transfusions, her health was declining. As an alternative treatment, her physician administered 5-azacytidine to induce transcription of the fetal β hemoglobin chain to replace her missing β chain. This drug activates gene transcription by removing methyl groups from DNA. Addition of methyl groups silences genes. However, the physician expressed concern that approximately 40 percent of all human genes are normally silenced by methylation. Nevertheless, after several weeks of 5-azacytidine treatment, the patient's condition improved dramatically. Although the treatment was successful, use of this drug raises several important questions.
Why was her physician concerned that a high percentage of human genes are transcriptionally silenced by methylation?
Case summary:
A 30-year-old woman with β-thalassemia had been treated with a blood transfusion since the age of 7. In spite of transfusions, her health was declining. So, in order to improve the health, her physician gave her 5-azacytidine to induce transcription of fetal β hemoglobin chain to replace the missing β chain.
Characters in the case:
A 30-year-old woman with a recessively inherited genetic disorder called β-thalassemia.
Adequate information:
Her health was declining in spite of transfusions and her physician gave her alternative treatment of 5-azacytidine for the induction of transcription of fetal β hemoglobin. This drug helps in activating transcription of genes by removing methyl groups.
To determine: The concern of the physician about the fact that a high percentage of human genes is transcriptionally silenced by methylation.
Explanation of Solution
Given the information:
Addition of methyl groups silences approximately 40% (percent) of all human genes by methylation.
Beta thalassemia is a recessively inherited genetic disorder. This disorder is characterized by the reduction in the production of beta chains of the hemoglobin molecule. The person suffering from this disorder is not able to produce the hemoglobin in sufficient amount and it leads to the anemic condition of the patient. Hemoglobin is an iron-containing protein of erythrocytes, which helps in carrying the oxygen throughout the whole body. Deficiency in this protein leads to an anemic condition of the body.
In this case, the woman is having β-thalassemia and is cured by regular transfusion of blood. But, her physician provides her with an alternative treatment of 5-azacytidine for induction of fetal β globin genes. This drug is very effective in increasing the synthesis of gamma-globin genes. The production of globin genes by reactivation of fetal globin genes rapidly occurs in bone marrow cells of the patient.
Methylation of DNA (deoxyribonucleic acid) is very necessary for controlling the expression of genes. Methylation of DNA takes place at the globin synthesis site during the treatment. DNA methylation helps in controlling or repressing the gene transcription and helps in the normal development of the body. So, this drug acts by removing the methyl groups from the DNA and thereby activating the transcription of genes responsible for producing fetal β globin genes. So, if a high number of human genes is transcriptionally silenced by methylation, there would be the possibility of production of lethal and mutagenic effects or lesions.
Thus, it can be concluded that the treatment of thalassemia by providing 5-azacytidine is a good option. It enhances the beta globin chains production by silencing the methylation of certain genes.
Want to see more full solutions like this?
Chapter 12 Solutions
Essentials of Genetics (9th Edition) - Standalone book
- E22. The method of Northern blotting is used to determine the amount and size of a particular RNA transcribed in a given cell type. Alternative splicing (discussed in Chapter 12) produces mRNAs of different lengths from the same gene. The Northern blot shown here was made using a DNA probe that is complementary to the MRNA encoded by a particular gene. The mRNA in lanes 1 through 4 was isolated from different cell types, and equal amounts of total cellular MRNA were added to each lane. 2 3 4 Lane 1: MRNA isolated from nerve cells Lane 2: MRNA isolated from kidney cells Lane 3: MRNA isolated from spleen cells Lane 4: MRNA isolated from muscle cells Explain these results. | |arrow_forwardin m 5'- 3'- Shown below is a schematic diagram illustrating a very short gene with 3000 bp region of an unknown Escherichia coli genome. (Note: Transcription starts at Transcription Start Site (TSS).) TSS -3' -5' +1 (i) Name the specific regions that can be recognized by sigma factor and indicate the locations in the diagram above. (ii) How does Sigma factor trigger the initiation of transcription?arrow_forwardE32. In the technique of DNase I footprinting, the binding of a protein to a region of DNA protects that region from digestion by DNase I by blocking the ability of DNase I to gain access to the DNA. In the DNase I footprinting experiment shown here, a researcher began with a sample of cloned DNA 400 bp in length. This DNA contained a eukaryotic promoter for RNA polymerase II. The assembly of general transcription factors and RNA polymerase II at the core promoter is described in Chapter 12 (see Figure 12.14). For the sample loaded in lane 1, no proteins were added. For the sample loaded in lane 2, the 400-bp fragment was mixed with RNA polymerase II plus TFIID and TFIIB. 2 400 350 250 175 50 Which region of this 400-bp fragment of DNA is bound by RNA polymerase II and TFIID and TFIIB? || III ||| | ||||arrow_forward
- GTTTTCACTGGCGAGCGTCATCTTCCTACT 8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.arrow_forwarda. Why is it impossible to induce nonsense mutations(represented at the mRNA level by the triplets UAG,UAA, and UGA) by treating wild-type strains with mutagens that cause only A• G → T• C transitions in DNA?b. Hydroxylamine (HA) causes only G• C → A• T transitions in DNA. Will HA produce nonsense mutations inwild-type strains?c. Will HA treatment revert nonsense mutations?arrow_forward. a. What are all the transversions that can be made starting with the codon CGG?b. Which of these transversions will be missense? Canyou be sure?arrow_forward
- a. What are all the transversions that can be made starting with the codon CGG?b. Which of these transversions will be missense? Can you be sure?arrow_forwardGTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where theprotein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; JournalName; Volume; Page Numbers) for a recent publication involving the identifiedgene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebratehomolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling,kinase, protease, etc.) of the protein(s) encoded by the gene.9. Generate a FULL protein sequence alignment for one of the…arrow_forwardTransforming an Animal In order to create the transgenic cow, your lab first needs to create a DNA vector containing the insulin gene. This step involves a considerable amount of scientific terminology. Make sure you understand the meaning of key terms. Match the following terms with their correct definitions. | ampicillin resistance gene 5 restriction site 6 Origin of replication 7 Ligase 2 promoter 3 Xhol Ч ехоn is a region of DNA that is not transcribed. is the location in the plasmid that is recognized by the restriction enzyme Xhol. is an enzyme that joins DNA fragments together. is the location on the plasmid where DNA replication begins. is a region of DNA that initiates transcription of a gene. is an restriction enzyme that looks for the sequence TCGA. is a gene that enables you to identify bacterial cells that have taken up the plasmid.arrow_forward
- Plz do explain.Thanks Question:- Many types of breast cancer have chromosomal translocation mutations. What scenario best describes, what occurs during this type of mutation, causing cells to proliferate abnormally? Chromosomal translocations may place the gene downstream near the promoter region, therefore causing over-expression of the gene The gene may be placed in the transcription start site, downstream of the gene, initiating transcription by recruiting polymerase II Translocation mutations will initiate the transcription of mRNA in the cytoplasm of the cell catalyzing protein synthesis. Chromosomal translocations can sometimes place a gene under the control of a powerful enhancer, upstream.arrow_forwardA 19 year old female patient is diagnosed with chronic myelogenous leukemia. Karyotype analysis shows that the leukemic cells of this patient are heterozygous for a reciprocal translocation involving chromosomes 9 and 22. However, none of the normal, nonleukemic cells of this patient contain the translocation. a) Describe a molecular test to determine if chemotherapy given to the patient described would be completely succesful. (That is, devise a method to make sure that the patient's blood would be free of leukemic cells.) Be as specific as possible.arrow_forwardMethylation state of cytosines at the QRT gene promoter is tested in one pair of identical twins, Ana and Becca, at 1 year of age, again when they are 25 years old. At 1 year old, the twins' DNA is the same, and this part of the genome is not methylated. At age 25, Ana's DNA remains unmethylated, but Becca's cells show methylation at this site in skin cells. a. What most likely caused this change in Becca? i. A mutation event ii. An environmental stimulus b. When the twins were 1 year old, QRC mRNA was expressed at similar levels in both Ana and Becca. At age 25, which twin likely expresses more of the QRC mRNA? i. Ana, whose QRC promoter DNA is unmethylated ii. Becca, whose QRC promoter DNA is methylated iii. Both are the same C. At age 25, which twin has more tightly packed chromatin in the region of the QRC gene? Explain briefly. i. Ana, whose QRC promoter DNA is unmethylated ii. Becca, whose QRC promoter DNA is methylated iii. Both are the same d. Some of Becca's skin cells, in…arrow_forward
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning