Figure 2 illustrates how Pitx1 transcription is regulated in different tissues. The center image is that of a stickleback embryo. The drawings in the surrounding boxes show the Pitx1 gene region and activator proteins present in the jaw, pelvis, eye, or pituitary tissues. Note that for simplicity, we are only showing one activator molecule present in a particular tissue. In reality, many activators are present in a particular tissue at any one time. Activator molecules with specific shading can bind to switches with the same shading. 1. List all the tissues shown in Figure 2 that express the Pitx1 gene.
Q: Like all viruses, HIV must utilize the host: ○ a. reverse transcriptase. ○ b. ribosomes. О с.…
A: HIV (Human Immunodeficiency Virus) is a retrovirus that targets CD4+ T cells in particular,…
Q: The classic inflammatory response (heat, swelling, redness, pain) reflects the communication of…
A: The classic inflammatory response is a complex and coordinated series of events orchestrated by the…
Q: What aspects of food analysis and quality assurance should be explored in order to contribute…
A: Today's market is a global market and lots of processed foods are available to choose from. It is…
Q: What is the cotransduction coefficient of histidine and valine? For consistency, standardize on…
A: We can determine the cotransduction coefficient of histidine and valine, we need to calculate the…
Q: henotype Frequency lele Frequency enotype Frequency nvironment: Polluted Forest Moths Released G1 G₂…
A: Gene is the basic unit of heredity. A gene exists in two alternative forms called alleles. When both…
Q: Trophic Cascade Concept Map Primary Producers: Include at least two different types of primary…
A: Trophic Cascade Concept Map Primary Producers:Grass (Plant):Herbivores:RabbitGrasshopperAlgae…
Q: Which process is responsible for creating unique recombinant chromosomes during meiosis?
A: The objective of the question is to identify the process that leads to the creation of unique…
Q: Your animal cell culture laboratory suddenly suffered from a bacterial contamination. Several…
A: B. The media is probably contaminated with Mycoplasma, due to the lack of cell walls they are the…
Q: A brief introduction covering the role of Ca2+ channels in the heart and of what is known currently…
A: Calcium ion (Ca2+) channels play a crucial role in regulating the electrical activity of the heart…
Q: Select all the correct answers. Which two statements are true for the leading strand in DNA? n ப It…
A: During DNA replication, the double helix unwinds and each strand serves as a template for creating a…
Q: Summarize the differences between deterministic and stochastic models of disease.
A: Deterministic models are the models characterized by certainty and predictability since they always…
Q: Compare the shape and uses of simple carbohydrates (like monosaccharides and disaccharides) with…
A: Carbohydrates are one of the macromolecules and chemically they can be defined as the polyhydroxy…
Q: What are the differences between sterilization, disinfection, antisepsis, degermination, and…
A: Sterilization, disinfection, antisepsis, degermination, and sanitization processes are essential for…
Q: Given the allele frequencies below, what would be the expected genotype frequencies in the next…
A: The link between genotype and allele frequencies in a population is described by the Hardy-Weinberg…
Q: Peripheral blood cell morphology in aplastic anemia is most often: Question 9 options:…
A: The question is asking about the most common peripheral blood cell morphology in aplastic anemia.…
Q: The factors contributing to the prevalence of Type 2 diabetes among Jamaicans
A: The objective of the question is to identify and explain the factors that contribute to the high…
Q: The Eustachian tube is important for equalizing air pressure within the middle ear. True…
A: The question is asking whether the Eustachian tube plays a role in equalizing air pressure within…
Q: A man was prescribed barbiturates 6 months ago. However, with time the physician had to increase the…
A: Barbiturates are a class of drugs that act as central nervous system (CNS) depressants which were…
Q: Crossmatching donor red cells for a patient involves combining: Question 2 options:…
A: The objective of the question is to identify the correct procedure for crossmatching donor red cells…
Q: A typical biological female is 46, XX, and a typical biological male is 46, XY. What do 46, XX, and…
A: The numbers and letters in '46, XX' and '46, XY' refer to the number and type of chromosomes found…
Q: James Smith is a nursing student in her last semester of nursing school. She is working with a…
A: The objective of the question is to determine whether James Smith, a nursing student, violated…
Q: stop codon. C Chr1 Bace2 180 180 Exon 1 Exon 2 Exon 3 Exon 5 Exon 7 Exon 9 Exon 4 Exon 6 Exon 8 200…
A: Nucleotides in DNA are arranged in exons or introns. Exons are the coding sequence whereas introns…
Q: Select the correct answer from each drop-down menu. Offspring inherit genes from their parents, and…
A: Mendel's laws, developed by Gregor Mendel in the nineteenth century, transformed genetics. The law…
Q: Write a set of directions for a red blood cell to deliver oxygen to the brain. Include all the words…
A: The most prevalent form of blood cell, red blood cells, scientifically defined as erythrocytes, are…
Q: Which month of the Roman year was originally designated as Sextilis, the second month of summer,…
A: The question is asking for the Roman month that was originally called Sextilis, which was the second…
Q: Central chemoreceptors... Question 12Answer a. Sense and respond to changes in O2 in the carotid…
A: The objective of the question is to identify the correct function of central chemoreceptors in the…
Q: Gene transcription is a complex process that involves specific interactions of proteins and…
A: Transcription is a part of gene expression. In this process RNA is synthesized with the help of…
Q: Scientific research on coral reef restoration
A: Title: Advancing Coral Reef Restoration Through Scientific Research and Innovative TechnologiesCoral…
Q: Bone development continues throughout adulthood. Even after adult stature is attained, bone…
A: Bone formation and maintenance are dynamic processes that occur throughout life, from infancy to…
Q: Which of the following events occurs due to a reduced sympathetic stimulation of the heart? Question…
A: The objective of the question is to understand the effects of reduced sympathetic stimulation on the…
Q: Based on our current understanding of human biological variation, explain why different human…
A: Based on our current understanding of human biological variation, explain why different human…
Q: abel the following graph, which indicates the temperature versus the percent of DNA that is single…
A: The melting temperature of DNA refers to the temperature at which 50% of a given DNA sample has…
Q: Provide a short answer for each of the questions below. For individuals homozygous for the Duffy…
A: The duffy protein is a glycoprotein expressed by duffy gene. It usually contains two antigens Fya…
Q: Hello Heliodors! (cont.) Trait B Heliodors are either red (R), yellow (Y) or an intermediate…
A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…
Q: 2. Compare your results to those of another lab group you think this is the case? 3. Is this…
A: Answer-1:- The genotype frequencies among the parents and their kittens in the second generation can…
Q: Which is an example of evolution? In Florida, the brown tree lizard has…
A: 4th Option: Due to global warming, the winters in Finland have been milder, resulting in less snow.…
Q: In an immune response, what is the main function of the circulatory system? to produce…
A: The question is asking about the primary role of the circulatory system during an immune response.…
Q: Genomic genealogy websites and services are becoming very popular. Recently a genealogy site was…
A: To determine family links and track ancestry, genomic genealogy uses both conventional genealogical…
Q: Third order neurons always have their cell bodies in the thalamus. True False
A: The given statement is False. Third-order neurons, part of sensory pathways in the central nervous…
Q: Key: with glucose without glucose
A: The image shows a bar graph with the rate of CO_2 production on the y-axis, measured in parts per…
Q: What is the null hypothesis during the above sobriety tests (favored by the defense attorneys)?…
A: The objective of the question is to identify the null hypothesis during sobriety tests. The null…
Q: The inner membrane of the mitochondria is analogous with which of the following in the chloroplast:…
A: The question is asking us to identify the part of the chloroplast that is analogous, or similar in…
Q: The per-capita birth rate of individuals in a population is 0.8, and the per-capita death rate of…
A: The objective of the question is to determine the change in the size of a population based on the…
Q: Which of the following does NOT describe enzyme-catalyzed rate acceleration derived from the binding…
A: Enzymes, as biological catalysts, exhibit remarkable efficiency in speeding up chemical reactions…
Q: 3'- AATAAAAAAGGTCCCAAAAAATTAGGGGAGACGGTACATAAA GAGTAGAGTCATAAATTTTAGAGATGCGTA - 5'
A: Following the hints and considering the complementary strand is required:Complementary DNA strand:…
Q: Polypeptide Handout Amino acids are linked together to form a peptide bond through an aminidation…
A: When two or more amino acids are linked together by peptide bond then a polypeptide is…
Q: Which of the following statements regarding hemoglobin (Hb) saturation are true? a. On top of…
A: The question is asking us to evaluate the truthfulness of several statements about hemoglobin (Hb)…
Q: What are the advantages of being social for primates? What altruistic behaviors have been observed…
A: Mammals classified as primates include humans, apes, monkeys, and prosimians including tarsiers,…
Q: QUESTION 1 The relative amounts of each nucleotide base are tabulated below for four different…
A: Virus I:Single-stranded DNAVirus II:Single-stranded RNAVirus III:Double-stranded RNAVirus…
Q: Subject: Environmental Physiology True or false: Urine dilution by the loop of Henle is dependent on…
A: FalseExplanation:The loop of Henle plays a crucial role in urine concentration and dilution in the…
Part 2 Bio Question 1
Step by step
Solved in 4 steps
- Many genes whose expression is turned on by DNAdamage have been isolated. Loss-of-function mutations in the lexA gene lead to the expression of manyof these genes, even when there has been no DNAdamage. Would you hypothesize that LexA protein isa positive or a negative regulator? Why?The oscillatory clock that drives somite forma-tion in vertebrates involves three essential componentsHer7 (an unstable repressor of its own synthesis), Delta (atransmembrane signaling molecule), and Notch (a trans-membrane receptor for Delta). Notch is bound by Delta onneighboring cells, activating the Notch signaling pathway,which then activates Her7 transcription. Normally, thissystem works flawlessly to create sharply defined somites(Figure Q21–2A). In the absence of Delta, however, onlythe first five somites form normally, and the rest are poorlydefined (Figure Q21–2B). If a pulse of Delta is suppliedlater, somite formation returns to normal in the regionswhere Delta was present (Figure Q21–2C). A diagram ofthe connections between the components of the clockand how they interact in adjacent cells is shown in FigureQ21–2D. In the absence of Delta, why do the cells becomeunsynchronized? What is it about the presence of Deltathat keeps adjacent cells oscillating in synchrony?a hormone receptor gene is deleted from the genome of a cell.in the absence of the hormone,what would you except about the expression of a gene that is activated by the hormone signiling?what would you expect to happen to the gene expression if the same cell is now treated with hormone?
- Figure 9.10 In certain cancers, the GTPase activity of the RAS G-protein is inhibited. This means that the RAS protein can no longer hydrolyze GTP into GDP What effect would this have on downstream cellular events?I. The retinoic acid receptor (RAR) is a transcription factor that is similar to steroid hormone receptors. Thesubstance (ligand) that binds to this receptor is retinoicacid. One of the genes whose transcription is activatedby retinoic acid binding to the receptor is myoD. Thediagram that follows shows a schematic view of theRAR proteins produced by genes into which one oftwo different 12-base double-stranded oligonucleotides had been inserted in the ORF. The insertion site(a–m) associated with each mutant protein is indicatedwith the appropriate letter on the polypeptide map.For constructs encoding proteins a–e, oligonucleotide 1(5′ TTAATTAATTAA 3′ read off either strand) wasinserted into the RAR gene. For constructs encoding proteins f–m, oligonucleotide 2 (5′ CCGGCCGGCCGG 3′)was inserted into the gene.NH2 f g h i j k l m COOHa b c d eThe wild-type RAR protein can both bind DNA and activate transcription weakly in the absence of retinoic acid(RA) and strongly in RA’s presence. Each…3. Figure 2 illustrates how Pitx1 transcription is regulated in different tissues. The center image is that of a stickleback embryo. The drawings in the surrounding boxes show the Pitx1 gene region and activator proteins present in the jaw, pelvis, eye, or pituitary tissues. a. List all the tissues shown in Figure 2 that express the Pitx1 gene. b. If a fish does not produce activator 1 proteins because of a mutation in the gene that encodes those proteins, Pitx1 will be expressed in which of the following tissues? c. If a fish does not produce activator 3 proteins, Pitx1 will be expressed in which of the following tissues? d. A fish inherits a mutation in the Pitx1 coding region. This is a nonsense mutation that introduces a premature stop codon, resulting in a nonfunctional protein. Where would you expect Pitx1 to be expressed in this scenario?
- The Wnt planar polarity signaling pathway nor-mally ensures that each wing cell in Drosophila has a sin-gle hair. Overexpression of the Frizzled gene from a heat-shock promoter (hs-Fz) causes multiple hairs to grow frommany cells (Figure Q15–5A). This phenotype is suppressedif hs-Fz is combined with a heterozygous deletion (DshΔ)of the Dishevelled gene (Figure Q15–5B). Do these resultsallow you to order the action of Frizzled and Dishevelledin the signaling pathway? If so, what is the order? Explainyour reasoningIn flies, the gap gene kruppel is expressed in a broad band in the middle of the embryo with giant expressed as its anterior border and knirps at its posterior border. How is the expression of kruppel limited to this band in the embryo? Describe the spatial regulation of the kruppel gene.TGF-β1 is a protein that affects cell growth and differentiation. Scientists conducted an experiment where epithelial cells were treated with transforming growth factor beta 1 (TGF-β1) in the laboratory. At the end of the experiment, the epithelial cells had transformed through several stages from epithelial cells to embryonic stem cells (ESCs) to neural progenitor cells (NPCs), and finally to cortical neurons (CNs). The scientists observed the transformation of the cells by analyzing gene expression at certain stages (M1-M7) and determined the relative gene expression level, as shown in the graph. The graph shows the relative gene expression level for cells at different stages of differentiation. Which of the following claims could account for the differences in gene expression at each stage of cell differentiation, and how does this correlate with the distance of the genes on the chromosome? A - Cell differentiation is controlled by RNA translation, but there is no…
- LO: Explain how mutations in regulatory regions of genes differ from mutations in coding region The presence or absence of pelvic spines in the stickleback fish is controlled by whether the Pitx1 gene is expressed in the pelvic tissue. The Figure below shows how Pitx1 transcription is regulated in different tissues. The center image is that of a stickleback embryo. The drawings in the surrounding boxes show the Pitx1 gene region and activator proteins present in the jaw, pelvis, eye, or pituitary tissues. While the diagram only shows one activator in one tissue, many activators are present in a particular tissue at any one time. Activator molecules with specific shading can bind to switches with the same shading. 3a) Based on the diagram, in which tissues will the PitX1 gene be expressed? 3b) Assume a fish inherits a deletion mutation in the pituitary switch/enhancer sequence. You isolate DNA from jaw, pelvic, eye, and pituitary tissues. In the DNA of which tissue(s) would…Expression of ---- does not require new protein synthesis. a.immediate early genes b. delayed early genes c. late genes. One growth factor can activate different pathways because ---- a. growth factor receptor dimerizes b. receptor transphosphorylates c. each receptor binds to several different proteins that have SH2 domains d. structural changes occur in proteins of signal transduction pathway. According to Knudson’s two-hit hypothesis, in children with familial retinoblastoma, a. only a single somatic mutation is needed to eliminate Rb function. b. children have genetically wild type gene at the Rb locus, and retinoblastoma development requires two successive somatic mutations c. both a and b are a possibility Methylation of a promoter results in a. overexpression of the downstream gene b. suppression of expression of the downstream gene.In Drosophila, both fushi tarazu (ftz) and engrailed (eng) genes encode homeobox transcription factors and are capable of eliciting the expression of other genes. Both genes work at about the same time during development and in the same region to specify cell fate in body segments. To discover if ftz regulates the expression of engrailed;if engrailed regulates ftz; or if both are regulated by another gene, you perform a mutant analysis. In ftz embryos (ftz/ ftz) engrailed protein is absent; in engrailed embryos (eng/eng) ftz expression is normal. What does this tell you about the regulation of these two genes—does the engrailed gene regulate ftz, or does the ftz gene regulate engrailed?