Answered: Question 4. Which enzyme is used in the…

Name: Question 4. Which enzyme is used in theprocessing of miRNAs that are
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Question 4. Which enzyme is used in theprocessing of miRNAs that are encoded in thegenome but NOT in the processing of exogenouslyadded siRNAs?

Science

Biology

Question 4. Which enzyme is used in the processing of miRNAs that are encoded in the genome but NOT in the processing of exogenously added siRNAs?

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter16: Gene Expression

Section: Chapter Questions

Problem 38CTQ: A scientist discovers a virus encoding a Protein X that degrades a subunit of the elF4F complex....

See similar textbooks

Similar questions

Any mutation inside or outside a coding regionthat reduces or abolishes protein activity in one of the manyways previously described is a loss-of-function _______?
GTTTTCACTGGCGAGCGTCATCTTCCTACT 8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.
Bong Question #1: The diagram below depicts the regulatory regions for two (made-up) genes, which contain cis-regulatory sequences X, Y, and Z and bind to transcriptional regulatory proteins: zelo led diogot bolgate SMARTY – a transcriptional ACTIVATOR protein, which is present in all neuronal cells and binds to cis-regulatory sequence, X1oq & vino 19vewod.152 moldong sai mut tum BRAWNY-a transcriptional ACTIVATOR protein, which is present in all muscle cells and binds to cis-resgulatory sequence, Yolgulum di ko malo na SNARKY - a transcriptional REPRESSOR protein, which is present in peripheral neurons only and binds to cis-regulatory sequence Z 100 bio se i da se lotimo broup gniwollt od 19 bolgate ons zegg or we de base do no me to stir noitesup od went of sistemos seu anoitesup 15wens horle 10oldog woy ni gnius stoted 1910 ni tatayot ovizasovo got no rade od lliw anioq azia oo ingene Aroom or b X y Jeol VELY gan 100 Tonnodige ΤΑΤΑ, 229nibrow dong H .aodto diw atse meldong mov.no o…
A scientist discovers a virus encoding a Protein X that degrades a subunit of the elF4F complex. Knowing that this virus transcribes its own mRNAs in the cytoplasm of human cells, why would Protein X be an effective virulence factor?
What processing step enhances the stability of pre-tRNAs and pre-rRNAs? methylation nucleotide modification cleavage splicing
Question 1: While examining a gene related to calcium ion channels in humans (CACNA1S) you discover a nearby region that likely codes for an miRNA associated with CACNA1S. What evidence would lead you to this conclusion? Stated another way, what would the discovered DNA region look like to convince you that you had found an miRNA region associated with CACNA1S? (Hint: be mindful of the 3'- 5' or 5'-3' direction in your answer) A. The template strand coding for the miRNA contains regions identical to the template strand of the CACNA1s gene. B. The template strand coding for the miRNA contains regions identical to the coding strand of the CACNA1s gene. C. The template strand coding for the miRNA contains regions antiparallel to the template strand of the CACNA1s gene. D. The template strand coding for the miRNA contains regions antiparallel to the coding strand of the CACNA1s gene.
39/ 50 Which of these is the function of a poly (A) signal sequence? A. It adds the poly (A) tail to the 3' end of the mRNA B It codes for a sequence in eukaryotic transcripts that signals termination of transcription-10-35 nucleotides away C. It allows the 3' end of the mRNA to attach to the ribosome DR is a sequence that codes for the hydrolysis of the RNA polymerase It adds a 7-methylguanosine cap to the 3' end of the mRNA
Question Genes can be transcribed into mRNA, in the case of protein-coding genes, or into RNA, in the case of genes such as those that encode ribosomal or transfer RNAs. Define a gene. For the following characteristics, state whether they apply to (a) continuous, (b) simple, or (c) complex transcription units.i. Found in eukaryotesii. Contain intronsiii. Capable of making only a single protein from a given gene
Question 2: You decide to test how the presence or absence of nucleosomes affects transcription using an in vitro transcription assay in which a DNA template featuring a promoter and single reporter gene is transcribed with the addition of specific factors in a test tube. You get robust transcription when you combine template DNA, RNA Polymerase, NTPs, and four general transcription factors - TFIIA, TFIIB, TFIID, and TFIIE. However, if you assemble the template onto purified nucleosomes and purify the chromatin template, then you don't get transcription even when all of the transcription components have been added. You decide to try a slightly different experiment where you first preincubate the template with all the transcription components except NTPs, then assemble the template onto nucleosomes and purify the chromatin template. Now when you add the transcription components and NTPs, transcription proceeds just as well as it does when using the naked DNA template (compare lanes 1…
QUESTION 2 If you made a change in the DNA of a promoter sequence that inactivates the promoter, what would happen at the RNA level? O The DNA helicase would not be able to recognize and bind the DNA, so the RNA would not be made The mutation of the DNA would be carried through to the RNA sequence The RNA polymerase would not be able to recognize and bind the DNA, so no RNA would be made Nothing, because the RNA would be made as usual
Question 28 Introns Protein-coding sequences that need to be excised B Non-coding regions that need to be excised Protein-coding sequences that form part of the mature MRNA Non-coding regions that form part of the mature MRNA Question 29 Anomers are A Either the open chain structure or the cyclic structure, established through mutarotation B) Either L or D Cyclic monosaccharides that differ only in the positions of substituents at carbon (alpha or beta) The fifteen other stereoisomers of glucose Question 30 The nuclear lamina A is the site of ribosomal RNA (FRNA) synthesis maintains the shape of the nucleus encloses the nucleus to separate it from the cytoplasm D) regulates the entry and exit of molecules from the nucleus
Which statements are true? Explain why or why not.1 The consequences of errors in transcription areless severe than those of errors in DNA replication.2 Since introns are largely genetic “junk,” they do nothave to be removed precisely from the primary transcriptduring RNA splicing.3 Wobble pairing occurs between the first positionin the codon and the third position in the anticodon.4 During protein synthesis, the thermodynamics ofbase-pairing between tRNAs and mRNAs sets the upperlimit for the accuracy with which protein molecules aremade.5 Protein enzymes are thought to greatly outnum-ber ribozymes in modern cells because they can catalyzea much greater variety of reactions and all of them havefaster rates than any ribozyme.