Microbiology: An Introduction (13th Edition)
13th Edition
ISBN: 9780134605180
Author: Gerard J. Tortora, Berdell R. Funke, Christine L. Case, Derek Weber, Warner Bair
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 8, Problem 3R
Match the following examples of mutagens.
Column A | Column B |
___a. A mutagen that is incorporated into DNA in place of a normal base | 1. Frameshift mutagen |
___b. A mutagen that causes the formation of highly reactive ions | 2. Nucleoside analog |
___c. A mutagen that alters adenine so that it base-pairs with cytosine | 3. Base-pair mutagen |
___d. A mutagen that causes insertions | 4. Ionizing radiation |
___e. A mutagen that causes the formation of pyrimidine dimers | 5. Nonionizing radiation |
Expert Solution & Answer
Learn your wayIncludes step-by-step video
schedule05:07
Students have asked these similar questions
Match each of the terms in the left column to the bestfitting phrase from the right column.a. exome 1. a discrete part of a protein that provides a unitof functionb. de novo gene 2. a nonfunctional member of a gene familyc. gene desert 3. the joining together of exons in a gene indifferent combinationsd. pseudogene 4. most frequent residues, either nucleotide oramino acid, found at each position in asequence alignmente. syntenic block 5. set of genes related by processes ofduplication and divergencef. orthologs 6. chromosomal region with the same genes inthe same order in two different speciesg. naturalselection7. genes with sequence similarities in twodifferent species that arose from a commonancestral geneh. consensussequence8. genes that arose by duplication within aspeciesi. gene family 9. genomic DNA sequences containing exonsj. paralogs 10. gene-poor region of the genomek. alternativeRNA splicing11. recently evolved from intergenic DNAsequencesl. protein domain 12. progressive…
I.
The DNA template, 3'–CGTTACCCGAGCOCGTACGATTAGG–5', was exposed to a mutagen,
resulting in the following three templates.
2.
A.
3'–CGTTACCCGAGCCGTAACGATTAGG-5' nserti on
leuding to frame shift
B. 3-CGTTACCCGATCCGTACGATTAGG–5' Point - Transversin
C.
3'-CGTTACCCGAGCCGTTCGATTAGG–5'
Transition
I. Transcribe and translate each template and write down the primary sequence of the resulting
polypeptide/protein.
Describe how each of the mutations will affect the final protein product from the
corresponding template. N
met -gla - Ser- Ala -cys -Stup-d
Predict whether gene expression (from initiation of transcription to final protein product) would be
faster in a prokaryotic or eukaryotic cell. Explain your answer.
Original DNA Sequence:
TACAC CTTGG CGACGACT...
MRNA Sequence:
Amino Acid Sequence:
Mutated DNA Sequence #5 TACACCTT G G GACGACT... (Highlight the change)
What's the mRNA sequence?
What will be the amino acid sequence?
Will there likely be effects?
What type of mutation is this?
1. Which type of mutation is responsible for new variations of a trait?
2. Which type of mutation does not result in an abnormal amino acid sequence?
3.
Which type of mutation stops the translation of an mRNA molecule?
NO
Chapter 8 Solutions
Microbiology: An Introduction (13th Edition)
Ch. 8 - Briefly describe the components of DNA, and...Ch. 8 - DRAW IT Identify and mark each of the following on...Ch. 8 - Match the following examples of mutagens. Column A...Ch. 8 - The following is a code for a strand of DNA. a....Ch. 8 - Prob. 5RCh. 8 - Identify when (before transcription, after...Ch. 8 - Which sequence is the best target for damage by UV...Ch. 8 - You are provided with cultures with the following...Ch. 8 - Why are mutation and recombination important in...Ch. 8 - NAME IT Normally a commensal in the human...
Ch. 8 - Match the following terms to the definitions in...Ch. 8 - Match the following terms to the definitions in...Ch. 8 - Feedback inhibition differs from repression...Ch. 8 - Bacteria can acquire antibiotic resistance by all...Ch. 8 - Suppose you inoculate three flasks of minimal...Ch. 8 - Plasmids differ from transposons in that plasmids...Ch. 8 - Mechanism by which the presence of glucose...Ch. 8 - The mechanism by which lactose controls the lac...Ch. 8 - Two offspring cells are most likely to inherit...Ch. 8 - Which of the following is not a method of...Ch. 8 - Nucleoside analogs and ionizing radiation are used...Ch. 8 - Replication of the E. coli chromosome takes 40 to...Ch. 8 - Pseudomonas has a plasmid containing the mer...Ch. 8 - Ciprofloxacin, erythromycin, and acyclovir are...Ch. 8 - HIV, the virus that causes AIDS, was isolated from...Ch. 8 - Human herpesvirus-8 (HHV-8) is common in parts of...
Additional Science Textbook Solutions
Find more solutions based on key concepts
The light reactions of photosynthesis supply the Calvin cycle with A. light energy. B. CO2 and ATP. C. O2 and N...
Campbell Biology in Focus (2nd Edition)
What is the difference between cellular respiration and external respiration?
Human Physiology: An Integrated Approach (8th Edition)
QIdentify (stepwise) the process of purifying drinking water. What important contaminants are targeted by each ...
Brock Biology of Microorganisms (15th Edition)
Distinguish between microevolution, speciation, and macroevolution.
Campbell Essential Biology (6th Edition) - standalone book
All of the following processes are involved in the carbon cycle except: a. photosynthesis b. cell respiration c...
Human Biology: Concepts and Current Issues
Distinguish between the concepts of sexual differentiation and sex determination.
Concepts of Genetics (12th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- A certain section of the coding (sense) strand of some DNA looks like this: 5'- ATGGGCCACTCATCTTAG-3' It's known that a very small gene is contained in this section. Classify each of the possible mutations of this DNA shown in the table below. I Don't Know mutant DNA 5'- ATG GGCCACAGTTCTTAG-3' 5'- ATG GG CTCATCTTAG - 3' 5'- ATG GGCCACGCATCTTAG-3' Submit type of mutation (check all that apply) ооооо O point O silent O noisy ооооо insertion deletion insertion O deletion Opoint Osilent noisy insertion O deletion ооооо Opoint silent O noisy X S Ⓒ2023 McGraw Hill LLC. All Rights Reserved. Terms of Use | Privacy Center Accessibilityarrow_forwardwww D le C 3⁰ A B Indicate True (T) or False (F) for the following statements. Only use the letter (T/F) in the space provided 1. The name of this process is best known as Rho dependent termination 2. The enzyme C called DNA polymerase incorporates ribonucleotides into B called the mRNA False 3. The DNA region A contains inverted palindrome sequences which results in formation of a stem-loops structure 4. During this process, the structure D called terminating hairpin forms and increases the enzyme affinity which terminates transcriptionarrow_forwardMutations can arise in the absence of a mutagen. please explain your answer true falsearrow_forward
- Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…arrow_forwardYou are working in the lab with two known carcinogens found in cigarette smoke: Benzo(a)pyren (BaP) and nitrosamine ketone (NNK). BaP is an aromatic hydrocarbon and the mechanism of carcinogenesis is through oxidation reactions with DNA. NNK is a nitrosoamine. Describe how these two kinds of carcinogens lead to mutations. (Be detailed. Remember you are graded on effort/completeness.)arrow_forwardThere are dozens of common variations of the c-myc gene, which are associated with different types of cancer. Here are 3 variations of part of a sequence of the c-myc gene, located between nucleotides 180 and 201. The original sequence is given to you, as well as the sequences of 3 variations. The mutated nucleotide of each variation is annotated in gray. Use this information (picture) to answer the next two (2) questions 1. Which of the c-myc variations is least likely to cause a change in c-myc function?2. Which variation of c-myc produces a nonsense mutation?arrow_forward
- Although exposure to both types of radiation can cause DNA damage, ionizing radiation and UV affect DNA differently. Explain the differences in the types of mutation caused by these mutagens.arrow_forwardSome mutations affect changes in protein structure and function that can result in disease whereas other mutations have no significant effects on protein structure and function. - Please explain reasons for the above-mentioned statement. - Human civilization has resulted in a large number of potentially mutagenic chemicals (e.g. pesticides) and has changed the environment to increase the likelihood of encountering other mutagens, especially UV radiation. What roles should the authorities play in identifying mutagens and regulating their release into the environment? Please discuss the subject in detail.arrow_forwarda. Why is it impossible to induce nonsense mutations(represented at the mRNA level by the triplets UAG,UAA, and UGA) by treating wild-type strains with mutagens that cause only A• G → T• C transitions in DNA?b. Hydroxylamine (HA) causes only G• C → A• T transitions in DNA. Will HA produce nonsense mutations inwild-type strains?c. Will HA treatment revert nonsense mutations?arrow_forward
- Below are several DNA sequences that are mutated compared with the wild-type sequence. Eachis a section of a DNA molecule that has separated in preparation for transcription, so you are onlyseeing the template strand. For each mutated DNA sequence, translate and record the resultingamino acid sequence. What type of mutation is each? Wild-type sequence: 3’-T A C T G A C T G A C G A T C-5’ Mutated DNA Template Strand #1: 3’-T A C T G T C T G A C G A T C-5’Amino acid sequence of peptide:Type of mutation: Mutated DNA Template Strand #2: 3’-T A C G G A C T G A C G A T C-5’Amino acid sequence of peptide:Type of mutation: Mutated DNA Template Strand #3: 3’-T A C T G A C T G A C T A T C-5’Amino acid sequence of peptide:Type of mutation: Mutated DNA Template Strand #4: 3’-T A C G A C T G A C T A T C-5’Amino acid sequence of peptide:Type of mutation:arrow_forwarda. Some antibiotics, such as rifampin, interfere with the function of RNA polymerase. What biological process is rifampin disrupting? b. Some antibiotic-resistant M. tuberculosis bacteria have a single point mutation (CàT) in the rpoB gene that causes an amino acid change from serine (a polar amino acid) to leucine (a non-polar amino acid). What type of mutation is this? Do you expect this to have no effect, a small effect, or a large effect on the polypeptide produced? Explain your reasoning. c. The rpoB gene encodes a subunit of the bacterial RNA polymerase protein. The point mutation described in Question 2 causes a change in protein folding, which leads to the inability of the rifampin antibiotic to bind to the RNA polymerase. Which level(s) of protein structure is/are affected by this change?arrow_forwardSickle-cell hemoglobin differs from regular hemoglobin in just one amino acid. Normal hemoglobin is created from the codon GAA, which codes for glutamic acid while sickle-cell hemoglobin has the codon GUA, which codes for valine. This is an example of what type of mutation? * O Insertion O Silent mutation O Deletion O Substitution mutationarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
What is cancer? What causes cancer and how is it treated? *UPDATE*; Author: Cancer Treatment Centers of America - CTCA;https://www.youtube.com/watch?v=_N1Sk3aiSCE;License: Standard Youtube License