In active muscle cells, the pO2 is about 10 torr at the cell surface and 1 torr at the mitochondria (the organelles where oxidative metabolism occurs). Calculate the percentage of bound oxygen transported to the mitochondria of muscle cells by myoglobin (KD = 2 torr).

In active muscle cells, the pO2 is about 10 torr at the cell surface and 1 torr at the mitochondria (the organelles where oxidative metabolism occurs). Calculate the percentage of bound oxygen transported to the mitochondria of muscle cells by myoglobin (KD = 2 torr).

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter27: Metabolic Integration And Organ Specialization

Section: Chapter Questions

Problem 3P

See similar textbooks

Related questions

Q: Which of these are artificial sweeteners (Arts) and which are metabolized (Mtbs) by glycolysis?…

A: Artificial sweeteners are synthetic substitutes for sugars. These are sweet in taste and have less…

Q: Glycogenesis occurs in both muscle and liver. Select one: O True O False Glycogen is released from…

A: Glycogen is storage-type homopolysaccharide that contain two types of glucose polymers: amylose:…

Q: After doing the preliminary studies on redcrest protein extract, Tighnari proceeded with its…

A: Proteins are macromolecule comprised of amino acids linked by peptide bonds which forms a primary…

Q: How many NET molecules of ATP are produced during the Embden-Meyerhof pathway of glycolysis for…

A: Cellular respiration is the process how biochemical energy is generated from food. It involves the…

Q: Which of the following is considered an omega-6 fatty acid?

A: Since animals cannot synthesize omega-6 and omega-3 fatty acids, they must be obtained from their…

Q: what conditions bring about acidosis and alkalosis? what are the principle metabolic function of…

A: Acidosis is a condition in which there is excess H+ ions in the arterial plasma, while alkalosis is…

Q: Which of the following molecular formulas would be for an aldopentose? C4H8O4 C₂H₁408 C6H12O6…

Q: Adipocytes release uridine into the blood during fasting. Which hormone is found in the bloodstream…

A: Uridine is an important pyrimidine nucleotide required for RNA synthesis in living organisms. It is…

Q: Which of the following regarding the Electron Transport Chain is INCORRECT? It can accept electrons…

A: Aerobic metabolism of 1 molecule of glucose can produce 10 NADH (6 from acetyl CoA in TCA cycle + 2…

Q: There is a proposal that pyrazole could protect against the damaging effects of alcohol on the liver…

A: Alcohol toxicity happens due to excess consumption of alcohol in short period of time. Oxidative…

Q: Fill up the table below. For inferences, indicate the identity of the macronutrient being tested in…

A: Since you have posted a question with multiple sub-parts, we will solve first three sub-parts for…

Q: 1. Theoretically, a protein could assume a virtually infinite number of configurations and…

A: Since you have posted multiple questions, we will provide the solution only to the first question as…

Q: The initial velocities of two different enzyme-catalyzed reactions were measured over a series of…

A: Michaelis Menten postulated that free enzyme reacts with the substrate reversibly to form an…

Q: * 15-14 AG AG is +6.64 kJ/mole +1.59 kcal/mole for the reaction Citrate - = Isocitrate. is -267…

A: Since conditions inside the cell are different than standard temperature and pressure, biochemists…

Q: 3. Predict the effect of each of the following amino acid substitutions on the KM and keat of the…

A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…

Q: Uncouplers of oxidative phosphorylation are all expect: Select one: O a. thermogenin O b.…

A: INTRODUCTION: (Oxidative phosphorylation) The process by which ATP is formed as a result of the…

Q: Provide the name of the following nitrogen-containing heterocyclic base. Z-I N A NH TU

A: The four major classes of biological macromolecules are nucleic acids, proteins, lipids and…

Q: Draw the structure of ethanolamine sphingomyelin formed from linoleic acid Draw the structure of…

A: Sphingomyelin is an important component of both the monolayer of phospholipids in lipoproteins and…

Q: 4. Shown below is the structure of the anti-retroviral drug AZT. 5' HOCH, H 3 N₂ HN AZT H 12 H CH₂…

A: AZT is a drug that is used to treat HIV. HIV is a retro virus that causes the syndrome AIDS. When…

Q: 18:249, 12 refers to a fatty acid that contains: 18 carbons, 2 double bonds, and saturation at…

A: Fatty acids are the simplest type of lipids. They are carboxylic acids with hydrocarbon chain. They…

Q: Which of the following is an anomer of B-D-gulopyranose? O ОН I ОН т ОН I I ОН CH2OH II- Б ОН CH2OH…

A: Anomers are cyclic monosaccharides differing from each other in the configuration at carbon no -1…

Q: How are GMOs applications of biotechnology?

A: Introduction:- The question is all about the genetic technology where genetic modification takes…

Q: Briefly and in simple terms, describe the glycoside bond connecting two monosaccharides in a di- or…

A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…

Q: Which of the following reactions does not occur mammals? O pyruvate + NADH-lactate + NAD+ O…

A: Pyruvate is the end product of glycolysis. In the presence of oxygen, it enters aerobic respiration,…

Q: Hormones and other signaling molecules: definition. Classification of hormones by chemical…

A: Hormones are chemical substance that are produced by endocrine glands. While paracrine signaling…

Q: You are performing PCR for the first time using some new primers that are 25 nucleotides in length…

A: PCR is the process by which we increase the number of a specific nucleotide sequence. The PCR…

Q: 4. In the space below provide a mechanism for this reaction that proceeds through the intermediate…

A: Glycolysis is the process by which one molecule of 6-carbon glucose is broken down into 2 molecules…

Q: ATP is a source of free energy that drives unfavorable reactions. Which of the processes are coupled…

A: The free energy changes in chemical reactions are denoted by ΔG. ∆G = ∆H − T∆S where ∆H is the…

Q: 1. Acetyl-CoA labeled with ¹4C in both of its acetate carbon atoms is incubated with unlabeled…

A: The citric acid cycle, also called as the Tricarboxylic acid (TCA) cycle is the central metabolic…

Q: 5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above…

A: The DNA contain genes (functional unit) that encode protein molecules. Proteins are the "workhorses"…

Q: Which of these is not a reducing sugar

A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified as monosaccharides,…

Q: *Complete hydrolysis of glycerophospholipid yields equimolar amounts of glycerol, a fatty acid [16:1…

A: Lipids are classified into three groups as simple lipids, compound lipids, and derived lipids based…

Q: Are there anymore features that limit the protein configurations?

A: A protein's biological function depends on its three-dimensional structure. The 3D structure is…

Q: 3. Enzyme specificity. To determine the specificity of substrate binding for a particular…

A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…

Q: Which of the following is a structure of a sugar alcohol? Н I I H O CAB O CAR O CAP COOH OH нон CAT…

A: Sugar alcohols are formed when the aldehyde or keto group of the monosaccharide is treated with a…

Q: Which major biosynthetic pathways utilize PRPP? de novo purine synthesis lysine biosynthesis…

A: INTRODUCTION: De novo purine synthesis- it is the synthesis of complex molecules from simple…

Q: Biochemistry: List structural features of myoglobin and hemoglobin. State how each structural…

A: Introduction: Hemoglobin (Hb) and myoglobin (Mb) are hemeproteins that crystallized first in the…

Q: Describe two types of regulation of the enzyme glutamine synthetase and explain why the regulation…

A: When amino acids are degraded in the tissue, they release ammonia. Ammonia is toxic to the cell so…

Q: Write a short description of the physical characteristics of acid & enzymatic hydrolysates. What…

A: Introduction: The principle of the benedict test is that when reducing sugars when heated in the…

Q: One of your colleagues has obtained a sample of muscle phosphorylase b that is known to be…

A: Glycogen is storage-type homopolysaccharides that contain two types of glucose polymers: amylose:…

Q: The structure of a metalloenzyme active site is down below(black picture). Describe, from a chemical…

A: Methane monooxygenase (MMO) is present in methanotrophic bacteria and MMO is present in an integral…

Q: In a famous experiment, Matthew Meselson and Franklin Stahl grew E. coli cells in a medium…

A: DNA replication is a process by which each strand of DNA acts as a template and copies itself to…

Q: 21. _____________________________________ adds acyl groups to two carbons of the backbone of…

A: Triacylglycerol (TAG) are compounds which has 3 acyl groups attached to a glycerol molecule. Fatty…

Q: The last residue of the protein (tail) is Tryptophan, and the first residue (head) is labeled with…

A: Fluorescence Resonance Energy Transfer (FRET) or simply RET is a technique used to calculate the…

Q: Phosphoenolpyruvate (PEP) is converted to pyruvate by the enzyme pyruvate kinase. The standard free…

A: The standard free energy change (∆Gº') is the amount of energy released in of biochemical reaction…

Q: The PDH complex is a logical point of regulation in metabolism, as it links two major catabolic…

A: Cellular respiration is a collection of three metabolic pathways that generate ATP the energy…

Q: 17-21 Is the rea (PEP) a re

A: Glycolysis is the process of breaking down glucose into two pyruvate molecules results in the…

Q: Substances like phencyclidine (PCP, or "angel dust") and ketamine ("Special K") are characterized…

A: INTRODUCTION : Phencyclidine : It is a synthetic drug, which is a compound being derived from…

Q: When tissue of the body are unloading CO2 into the blood, what best describes what happens to most…

A: Hemoglobin is a protein found in RBC. In addition to carrying oxygen from the lungs to the tissues,…

Q: what are correct about enzyme kinetic parameters

A: Enzymes are high molecular-weight proteins that catalyse biochemical reactions. They contain an…

Question

100%

In active muscle cells, the pO2 is about 10 torr at the cell surface and 1 torr at the mitochondria
(the organelles where oxidative metabolism occurs). Calculate the percentage of bound oxygen
transported to the mitochondria of muscle cells by myoglobin (KD = 2 torr).

Chemical pathways by which living things function, especially those that provide cellular energy, such as the transformation of energy from food into the energy of ATP. Metabolism also focuses on chemical pathways involving the synthesis of new biomolecules and the elimination of waste.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Fractional Saturation (Y)

VIEW

Calculation and final answer

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.

Similar questions

Heart and muscle cells, where myoglobin resides, maintains an intracellular pO2 of about 2.5 torr. Calculate the fractional saturation (for human myoglobin) if a small change (1 torr) in oxygen partial pressure occurs in either direction (ie what happens at 1.5 torr, what happens at 3.5 torr?) and explain how a small change in oxygen pressure dramatically changes the myoglobin oxygen binding.
In human resting muscle cells, the concentration of ATP is 4 mM, ADP is 0.013 mM, creatine-phosphate is 25 mM and creatine is 13 mM. Calculate the ΔG for the formation of creatine phosphate from ATP and creatine in kJ/mol and do not include unit in your answer.
In active muscle cells, the pO₂ is about 10 torr at the cell surface and 1 torr at the mitochondria (the organelles where oxidative metabolism occurs). Calculate the percentage of bound oxygen transported to the mitochondria of muscle cells by myoglobin (KD = 2 torr). A new oxygen transport protein that exhibits cooperative binding has been isolated and is being studied in the lab. Calculate the Ko value if Y = 0.76 when pO₂2 = 18 torr (assume n = 2.5). How does this compare to the K₂ value for hemoglobin? Does this protein bind more or less tightly to oxygen compared to hemoglobin?
The dissociation constant is defined by p50 = 2.8 torr for myoglobin binding to oxygen. What is partial pressure of oxygen when half of the myoglobin proteins in solution are bound to oxygen?
Assume that the complete combustion of one mole of glucose to carbon dioxide and water liberates 2870 kJ/mol (AGo' = -2870 kJ/mol). If one contraction cycle in muscle requires 67 kJ, and the energy from the combustion of glucose is converted with an efficiency of 35% to contraction, how many contraction cycles could theoretically be fueled by the complete combustion of one mole of glucose? Round your answer to the nearest whole number. суycles per mole glucose
What is the Keq for the conversion of Glucose 6-Phosphate to Glucose 1-Phosphate if the phosphate transfer potential for Glucose 1-Phosphate and Glucose 6-Phosphate are -20.9 kJ/mol and -13.8 kJ/mol respectively? Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a 0.27 b 0.45 c 10.5 d 0.019 e 0.057 f 24.2 g 7.10 h 0.24 i 2477
Intracellular concentrations in resting muscle are as follows: fructose6-phosphate, 1.0 mM; fructose-1,6-bisphosphate, 10 mM; AMP, 0.1 mM;ADP, 0.5 mM; ATP, 5 mM; and Pi, 10 mM. Is the phosphofructokinasereaction in muscle more or less exergonic than under standard conditions?By how much?
Intracellular concentrations in resting muscle are as follows: fructose- 6-phosphate, 1.0 mM; fructose-1,6-bisphosphate, 10 mM; AMP, 0.1 mM; ADP, 0.5 mM; ATP, 5 mM; and P, 10 mM. Is the phosphofructokinase reac- tion in muscle more or less exergonic than under standard conditions? By how much?
Assume that during a 400-m running race, the pH decreases in muscle cells from 7.6 to 7.0 while the pO2 remains constant at 40 mm Hg. What is the effect on the oxygen binding of hemoglobin in the muscle cells? What is the implication of this? What is the effect on myoglobin?
0.75/ Question 20 What is the difference between treppe and tetany? Mark ALL that apply. there is no summation in tetany there is no summation in treppe the contractions successively increase giving a "staircase" image treppe goes away after muscle is fully warmed up treppe is caused by gradual warming of an unstimulated muscle thus increasing diffusion of ions and protein movement needed to cause contractions.
Compute the oxygen cost of cycling (ml · kg-1 · min-1) at work rates of 50, 75, 100, 125 W for a 60-kg person.
In a rat cardiomyocyte, the levels of creatine, phosphocreatine, and free phosphate were found to be 37.6mM, 40.3mM, and 8.02mM, respectively. Given that the standard free energy change is –43.0 kJ/mol, what is the true free energy change for phosphocreatine hydrolysis in the cardiomyocyte described above?