the target DNA
Q: Next generation sequencing using Illumina platforms identifies individual bases in a DNA fragment…
A: The following steps are involved in next generation sequencing: 1) First the DNA sequencing…
Q: In addition to identifying the genetic material, the experiments of Avery and colleagues with…
A: The existence of DNA as genetic material can be proved by the facts such as: the total DNA content…
Q: . The table opposite shows the standard (coding strand) DNA rinlet codes for the 20 amino acids…
A: Introduction :- The process of protein synthesis occurs in two steps which are transcription and…
Q: 2 Make a drawing of the simple recombinant plasmid PAMP/PKAN containing only the 3755bp and 1875bp…
A: One intriguing scenario is the union of the 3755-bp pAMP fragment with an origin of replication for…
Q: You have the plasmid pUC18/19, which is a circular plasmid that consists of 2686 bp. What would the…
A: Restriction enzymes are molecules that cleave nucleic acid (DNA) at a specific sequence. Restriction…
Q: 8. The following diagram represents the Christmas-tree-like structures during transcript On the…
A: E. Eliminators are viewed downstream of the quality as deciphered, and ordinarily happen…
Q: 1. Below is a partial sequence of a guide RNA. The underlined section of the RNA is designed to…
A:
Q: #16) The restriction enzymes Xhol and SalI cut their specific sequences as shown below: XhoI 5' C |…
A: The sticky ends generated after cleavage by the Xho1 and Sal1 are shown on the white board.
Q: DNA synthesis has a very low error rate. One reason for this is that the DNA polymerase enzyme can…
A: DNA polymerase is the enzyme that does maximum of the work throughout DNA replication. It builds a…
Q: 1. For each of the sequences, place an X in the box to indicate the process most immediately…
A: Note: According to the guidelines, we are supposed to answer only one question. Please repost other…
Q: ing the gel picture of the DNA ladder, show where your digestion of the paper cutting model showing…
A: DNA is a double stranded biomolecule. The DNA is usually digested by endonucleases and exonucleases…
Q: 5) The restriction enzyme EcoRI recognizes the DNA sequence GAATTC and makes a staggered cut as…
A: Restriction enzymes have specific recognition site on DNA at which they binds and cut the DNA into…
Q: Slipped, mispaired DNA occurs when the DNA region has A. direct repeats. B.…
A: Slipped (SSM) strand mispairing is considered as a mutation process, in which occurs during the…
Q: What will be the mRNA produced from the given template? DNA Template 3 - ATTGCGGATGCCCGTATACG -5 DNA…
A: There are two types of nucleic acids, DNA and RNA. Nucleotides are the building blocks of nucleic…
Q: 1. The nontemplate strand of a segment of double- helical DNA contains the sequence:…
A: Since you have posted a question with multiple sub-parts, we will solve the first 2subparts for you.…
Q: DNA primase synthesizes a short RNA primer that later appears at the 5'-end of each Okazaki…
A: The given statement is TRUE
Q: 5' guanine cap 5' AUGCCGAUGCCUCCUAUCAGAUAAAAUAAA poly A tail AAAA 3' During DNA replication, a…
A: The mutation is the sudden and abrupt change in the structure and function of the chromosomes.
Q: 2. If you mixed the mRNA of a human gene with thegenomic DNA for the same gene and allowed theRNA…
A: The binding of single standard DNA on the basis of their complementary is known as hybridization.…
Q: 7. A segment of a DNA strand consists of ...GCTTAGACCTGA.... (a) Identify the expected nucleotide…
A: DNA to mRNA is transcription and mRNA to protein is translation.
Q: 2. Provide the sequences of the template and coding strands of a DNA double helix that was used to…
A: The RNA or ribonucleic acid is produced from the DNA by the transcription process. RNA is used for…
Q: 3 The restriction endonuclease PstI cuts DNA symmetrically on both strands at the СTGCAG sequence:…
A: Restriction endonucleases are the enzymes that are used to form cuts inside the DNA molecule. It is…
Q: Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’-T A C T G…
A:
Q: RNA is transcribed. Label the 5′ and 3′ ends of each strand. 17. The following sequence of…
A: During the process of transcription. RNA polymerase is the enzyme and its main function is to…
Q: Proofreads each nucleotide its template as soon as it is added to the growing strand. A) DNA Ligase…
A: DNA is a genetic material that uses transcription and translation to transfer genetic information to…
Q: 1)explain why it is far less important for RNA Polymerase to have proofreading activity than it is…
A: Fidelity of replication is the most important for the very existence of an organism. Besides its…
Q: Process by which the DNA sequences encoding exons are exchanged and reordered through genetic…
A: Exon :- the coding part of the gene. Intron :- the non coding regions of pre mature mRNa.
Q: You have a DNA sequence of 1400 bp. To characterize it, you decide to make a restriction map.…
A: DNA is a nucleotide polymer present in living beings.
Q: In order to target a specific region of genomic DNA with CRISPR, researchers must include a guide…
A: Abstract The CRISPR-Cas9 system, naturally a defense mechanism in prokaryotes, has been repurposed…
Q: most STR fragments used in human forensic analysis are comprised of_____ repeats
A: STR Stands for short tandem repeats, these are short sequences in DNA that make large subunits…
Q: You have isolated a fragment of viral DNA that supposedly encodes for two proteins, 196 and 220…
A: Expression of proteins from genes on DNA occurs in two steps - transcription and translation. During…
Q: 5' AGGGUUUGGGAUGAAUCGACGACGAUCCUACGUACUAAGUA 3' Write the amino acid sequence for this portion of…
A: Transcription is a process through which the template DNA strand is transcribed into mRNA. mRNA…
Q: 1. You are given with the DNA sequence in the leading strand template. See item number 1 in…
A: Since you have asked multiple questions , we will solve the first question for you. If you want any…
Q: 4a. Was this micrograph taken of a sample prepared from human cells or prokaryotic cells? How do you…
A: Since you have posted a question with multiple subparts, we will solve the first three subparts for…
Q: 1) You wish to make a restriction map of a 17.0 kb linear fragment. You digest the fragment with…
A: Restriction map is a map of the restriction sites present in gene/DNA sequence. Restriction enzymes…
Q: Following is the nucleotide sequence in a segment of a strand of DNA 5'- AATTGGCTCTATAAT-3' Give the…
A: Adenine, thymine, guanine, and cytosine are the bases of the DNA. The mRNA is a single-stranded…
Q: 1. The two sequences shown below are complementary to each other. T or F GTCGAC CAGCUG 2. Telomerase…
A: The image shows 10 statements. We have to determine whether the statement is True or False. The…
Q: transcription process of a prokaryotic gene. Redraw the diagram and label parts (i) to (v) on the…
A: Since there are multiple questions in this particular question, I'll answer the first three subparts…
Q: BamHI Haell Both 10 kb 9 kb 8 kb 5 kb 2 kb 1 kb Figure 2 (i) How long is the original DNA molecule?…
A: Restriction digestion is a process in which DNA is cut at specific sites,
Q: The following diagram represents a transcription unit in a hypothetical DNA molecule. 5′ … TTGACA ……
A: Bacterial transcription is the process in which a segment of bacterial DNA is copied into a newly…
Q: 1. The nontemplate strand of a segment of double- helical DNA contains the sequence:…
A: DNA => Transcription => mRNA => Translation => Protein. Given : Non-template strand…
Q: 1. A linear DNA molecule is subjected to complete restriction digestion by (1) EcoR1 alone, (2)…
A: Restriction enzyme or restriction endonuclease are bacterial protein that cleaves DNA at specific…
Q: A biochemist was able to sequence a DNA found in a human sample from humans who were first believed…
A: The DNA is a self-replicating structure formed of two strands. The DNA is formed of nucleotides. The…
Q: 8. You have a piece of DNA with the sequence shown below.…
A: EcoRI is one of the most commonly found restriction endonuclease and it is isolated from the E.…
Q: The short Okazaki fragments are Select one: a. spliced together by DNA ligase b. glued together by…
A: Replication is the process of synthesis of daughter stand from the parental strand by the action of…
Q: B. One strand of a section of DNA isolated from E. coli reads: (Assume no start codon is required as…
A: Deoxyribonucleic acid (DNA) is a macromolecule made of two strands that are complementary to each…
Q: Digestion of a DNA sample with Decll, which is a “4-cutter" enzyme that produces blunt (rather than…
A: A 4-cutter restriction enzyme means the recognition sequence of the enzyme is a 4 bp sequence. It…
Q: 1. Transcribe the DNA strand provided then determine the sequence of amino acids of the gene…
A:
Q: 7. Which of the following base sequences are probably not recognition sites for cleavage by…
A: Restriction endonucleases are the molecular cutters which is used to split DNA in the center but…
Q: 3) Analysis of the sequence of a DNA fragment shows the presence of restriction site for the enzyme…
A: The restriction site is the site which is a type of specific genetic sequence present on the DNA…
Q: Chimeric DNA true are all except - a) Formed by linking DNA fragments of unrelated nis ood l nsvi…
A: Chimeric DNA is also known as recombinant DNA which is formed by linking DNA fragments of two…
CRISPR repeat sequences
|
||
gRNA
|
||
Cas9 nuclease
|
||
tracrRNA
|
(b) encodes Guide RNAs
CRISPR repeat sequences
|
||
gRNA
|
||
Cas9 nuclease
|
||
tracrRNA
|
Step by step
Solved in 4 steps
- 1. (a) What will be the newly synthesized DNA from the template given? DNA Template 3 - CGGATGCCCGTATAC -5 3 - GCCTACGGGCATATG -5 5 - GCCTACGGGCATAAG -3 5 - GCCTACGGGCATATG -3 3 - CGGATGCCCGTATAC -5 (b) Which is the DNA template given if the mRNA is 5 - CGGAUGCCCGUAUACGUA -3 ? 3 - GCCTACGGGCATATGGTA -5 5 - GCCTACGGGCATAAGGAT -3 5 - GCCTACGGGCATATGCAT -3 3 - CGGATGCCCGTATACCTA -5#16) The restriction enzymes Xhol and SalI cut their specific sequences as shown below: XhoI 5' C | TCGAG 3' SalI | 5' GTCGAC 3' 3' GAGC | TC 5' 3' G | AGCTG 5' Can the sticky ends created by XhoI and SalI sites be ligated? If yes, can the resulting sequences be cleaved by either XhoI or SalI?EcoRI recognizes G A-A-T-T-C sequence and cleave/ cut between G and A. How will the DNA fragments look like if EcoRI is used for the DNA below? How many fragments are produced? 5- AAAGATTTGAATTTCGAATTCAATTTAAGAATTCCCTTAGAATTTCC -¹3
- Given Sequence: 3’-TACGGTCCGGATTCGGTAGCTAGCATC-5’ Provide: Complementary Strand: Transcript Amino Acid Sequence 2.Given Sequence: 5’-GGGCATATGCCGTTTACCGGTTTGACTAAATAACCA-3’ Provide: Complementary Strand: Transcript Amino Acid Sequence 3.Given Sequence: 3’-AAC CAA TAC GTG AGG ATA CCA AGT AAC ACT CCC-5’ Provide: Complementary Strand: Direct Transcript: Transcript for Translation: Amino Acid Sequence:1. (a) can pair with a segment of a Guide RNAs CRISPR repeat sequences gRNA Cas9 nuclease tracrRNA (b) All of the following describe the nonsynonymous substitutions EXCEPT: rates of substitution are uniform among sites alter amino acid sequence alter phenotype rates of substitution are lower1. (a) What will be the mRNA produced from the given template? DNA Template 3 - ATTGCGGATGCCCGTATACG -5 DNA Template 3 - ATTGCGGATGCCCGTATACG -5 3 - AUUGCGGAUGCCCGUAUACG -5 5 - AUUGCGGAUGCCCGUAUACG -3 5 - AUUGCGGAUGCCCGUAUACG -3 3 - UAACGCCUACGGGCAUAUGC -5 (b) What will be the anticodons that will arrive in the translation of mRNA below? mRNA 5 - AAUAUGCGGAUGCCCGAA -3 "AAU, AUG, CGG, AUG, CCC, GAA" "UAC, GCC, UAC, GGG, CAA" "AUG, CGG, AUG, CCC, GAA" "UUA, UAC, GCC, UAC, GGG, CAA"
- EcoRI recognizes GA-A-T-T-C sequence and cleave/ cut between G and A. How will the DNA fragments look like if EcoRI is used for the DNA below? How many fragments are produced? -'3 5'-AAAGATTTGAATTTCGAATTCAATTTAAGAATTCCCTTAGAATTTCC35.Draw a bacterial gene (dsDNA and mRNA) showing the promoter (-35 and -10 consensus sense strand sequences), the TC start site (TSS), start of TL, open reading frame (ORF), end of TL, TC termination site (TTS), 5’-UTR, and 3’-UTR. Some of these landmarks are on the dsDNA, some on the mRNA. The TSS and TTS can be drawn on both. Indicate 5’ and 3’ ends on dsDNA and mRNA. You may need to make a messy draft of this drawing as you are working through the details. Draw the TTS as it would fold after it has been transcribed and show basepairing between the mRNA and the template strand that is important for TC termination. Explain how this structure stops transcription.23. Design the forward, reverse, and internal primers to the gene below and mutate the bolded/underlined histidine (CAC) to an alanine (GCC). Primers are usually 18-25 nucleotides long, but only make primers 9 nucleotides long to save work. 5'-ATGGATCGATACGGACGAAATCACCTACCGAATCAGGCGTGACGTGA-3' External Forward: External Reverse: Internal Forward: Internal Reverse:
- (11) If you design a gRNA with the sequence, GGU AUC AUU GCA CUG ACC AG, in theory which position of the nucleotide in the genomic DNA sequence below will be cut by Cas9 protein, which may lead to a knockout due to an error in DNA repair? The starting and the end coordinate positions of the DNA fragment on the chromosome are indicated at the beginning and end of the sequence, respectively. 110,001 ATC GGT ATC ATT GCA CTG ACC AGA GGC TAC 110,030 A) Between 110,023 (G) and 110,024 (A) B) Between 110,021 (C) and 110,022 (A) C) Between 110,020 (C) and 110,021 (C) D) Between 110,009 (C) and 110,010 (A)The following illustrates a jagged double-strand DNA break resulting from Cas9 cleavage that occurred in the first step of genome editing using CRISPR-Cas9 technology: 5'-GCGCCGTCC 3'-CGCGGC CTGTCAGGCGACACT-3' AGGGACAGTCCGCTGTGA-5' Which of the double-stranded DNA sequences listed below (A-D) is expected to result from repair of the break above via non-homologous end joining? Note: this question is not asking what kinds of mutations result from NHEJ repair of Cas9 cleavage in general, but specifically what is expected to result from repair of the jagged cut illustrated above? In the answer choices below, sequences that are the same in all four options are shown in bold to help you spot the differences. A. 5'-GCGCCGCTGTCAGGCGACACT-3' 3'-CGCGGCGACAGTCCGCTGTGA-5' B. 5'-GCGCCGTCTGTCAGGCGACACT-3 3'-CGCGGCAGACAGTCCGCTGTGA-5' C. 5'-GCGCCGTCCCTGTCAGGCGACACT-3' 3'-CGCGGCAGGGACAGTCCGCTGTGA-5' D. 5'-GCGCCGAGACTGTCAGGCGACACT-3' 3'-CGCGGCTCTGACAGTCCGCTGTGA-5'www D le C 3⁰ A B Indicate True (T) or False (F) for the following statements. Only use the letter (T/F) in the space provided 1. The name of this process is best known as Rho dependent termination 2. The enzyme C called DNA polymerase incorporates ribonucleotides into B called the mRNA False 3. The DNA region A contains inverted palindrome sequences which results in formation of a stem-loops structure 4. During this process, the structure D called terminating hairpin forms and increases the enzyme affinity which terminates transcription