Homework Help is Here – Start Your Trial Now!
Science
Biology
You plan to clone exon 11 of the HEXA gene (Section C) into the multiple cloning site (MCS) of the plasmid vector pUC19 illustrated below. You PCR amplify only the 184 bp DNA region representing exon 11 of HEXA from human DNA as a blunt-ended dsDNA fragment, and purify the amplicon. Next you digest the vector pUC19 with the restriction enzyme (RE) Smal to obtain linear plasmid DNA. You mix the PCR product and linear plasmid, add some DNA ligase enzyme in an appropriate buffer, and incubate overnight at 16°C. The ligation mixture is used to transform competent E. coli cells, which are subsequently streaked out onto agar plates containing ampicillin, X-gal and IPTG. HEXA exon 11 sequence: attcagccagacacaatcatacaggtgtggcgagaggatattccagtgaactatatgaaggagctggaactggtc accaaggccggcttccgggcccttctctctgccccctggtacctgaaccgtatatcctatggccctgactggaag gatttctacatagtggaacccctggcatttgaag PUC 19 plasmid map: Amp 2686 1 0 lacZ EcoRI (390) Smal (410) BamHI (420) MCS Kpnl (430) LacR binding site Plac Pstl (440) pUC19 2686 bps PMB1 ori 4. Before you do the ligation reaction, you analyse the undigested pUC19 plasmid (lane 1), the SmaI-digested pUC19 (lane 2) and the PCR amplicon (lane 3) by agarose gel electrophoresis, and obtain the gel image provided below. The molecular weight marker (M) contains linear DNA fragments of the sizes as indicated on the left. Explain the banding pattern observed in lanes 1 and 2. [4] M 1 2 3 6500 4500 3000 2000 1000 100

You plan to clone exon 11 of the HEXA gene (Section C) into the multiple cloning site (MCS) of the plasmid vector pUC19 illustrated below. You PCR amplify only the 184 bp DNA region representing exon 11 of HEXA from human DNA as a blunt-ended dsDNA fragment, and purify the amplicon. Next you digest the vector pUC19 with the restriction enzyme (RE) Smal to obtain linear plasmid DNA. You mix the PCR product and linear plasmid, add some DNA ligase enzyme in an appropriate buffer, and incubate overnight at 16°C. The ligation mixture is used to transform competent E. coli cells, which are subsequently streaked out onto agar plates containing ampicillin, X-gal and IPTG. HEXA exon 11 sequence: attcagccagacacaatcatacaggtgtggcgagaggatattccagtgaactatatgaaggagctggaactggtc accaaggccggcttccgggcccttctctctgccccctggtacctgaaccgtatatcctatggccctgactggaag gatttctacatagtggaacccctggcatttgaag PUC 19 plasmid map: Amp 2686 1 0 lacZ EcoRI (390) Smal (410) BamHI (420) MCS Kpnl (430) LacR binding site Plac Pstl (440) pUC19 2686 bps PMB1 ori 4. Before you do the ligation reaction, you analyse the undigested pUC19 plasmid (lane 1), the SmaI-digested pUC19 (lane 2) and the PCR amplicon (lane 3) by agarose gel electrophoresis, and obtain the gel image provided below. The molecular weight marker (M) contains linear DNA fragments of the sizes as indicated on the left. Explain the banding pattern observed in lanes 1 and 2. [4] M 1 2 3 6500 4500 3000 2000 1000 100

Human Anatomy & Physiology (11th Edition)
Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:Elaine N. Marieb, Katja N. Hoehn
Chapter1: The Human Body: An Orientation
Section: Chapter Questions
Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...
See similar textbooks
icon
Related questions
Question
You plan to clone exon 11 of the HEXA gene (Section C) into the multiple cloning site (MCS) of the plasmid vector pUC19 illustrated below. You PCR amplify only the 184 bp DNA region representing exon 11 of HEXA from human DNA as a blunt-ended dsDNA fragment, and purify the amplicon. Next you digest the vector pUC19 with the restriction enzyme (RE) Smal to obtain linear plasmid DNA. You mix the PCR product and linear plasmid, add some DNA ligase enzyme in an appropriate buffer, and incubate overnight at 16°C. The ligation mixture is used to transform competent E. coli cells, which are subsequently streaked out onto agar plates containing ampicillin, X-gal and IPTG. HEXA exon 11 sequence: attcagccagacacaatcatacaggtgtggcgagaggatattccagtgaactatatgaaggagctggaactggtc accaaggccggcttccgggcccttctctctgccccctggtacctgaaccgtatatcctatggccctgactggaag gatttctacatagtggaacccctggcatttgaag PUC 19 plasmid map: Amp 2686 1 0 lacZ EcoRI (390) Smal (410) BamHI (420) MCS Kpnl (430) LacR binding site Plac Pstl (440) pUC19 2686 bps PMB1 ori
Transcribed Image Text:You plan to clone exon 11 of the HEXA gene (Section C) into the multiple cloning site (MCS) of the plasmid vector pUC19 illustrated below. You PCR amplify only the 184 bp DNA region representing exon 11 of HEXA from human DNA as a blunt-ended dsDNA fragment, and purify the amplicon. Next you digest the vector pUC19 with the restriction enzyme (RE) Smal to obtain linear plasmid DNA. You mix the PCR product and linear plasmid, add some DNA ligase enzyme in an appropriate buffer, and incubate overnight at 16°C. The ligation mixture is used to transform competent E. coli cells, which are subsequently streaked out onto agar plates containing ampicillin, X-gal and IPTG. HEXA exon 11 sequence: attcagccagacacaatcatacaggtgtggcgagaggatattccagtgaactatatgaaggagctggaactggtc accaaggccggcttccgggcccttctctctgccccctggtacctgaaccgtatatcctatggccctgactggaag gatttctacatagtggaacccctggcatttgaag PUC 19 plasmid map: Amp 2686 1 0 lacZ EcoRI (390) Smal (410) BamHI (420) MCS Kpnl (430) LacR binding site Plac Pstl (440) pUC19 2686 bps PMB1 ori
4. Before you do the ligation reaction, you analyse the undigested pUC19 plasmid (lane 1), the SmaI-digested pUC19 (lane 2) and the PCR amplicon (lane 3) by agarose gel electrophoresis, and obtain the gel image provided below. The molecular weight marker (M) contains linear DNA fragments of the sizes as indicated on the left. Explain the banding pattern observed in lanes 1 and 2. [4] M 1 2 3 6500 4500 3000 2000 1000 100
Transcribed Image Text:4. Before you do the ligation reaction, you analyse the undigested pUC19 plasmid (lane 1), the SmaI-digested pUC19 (lane 2) and the PCR amplicon (lane 3) by agarose gel electrophoresis, and obtain the gel image provided below. The molecular weight marker (M) contains linear DNA fragments of the sizes as indicated on the left. Explain the banding pattern observed in lanes 1 and 2. [4] M 1 2 3 6500 4500 3000 2000 1000 100
Expert Solution
steps

Step by step

Solved in 2 steps with 1 images

SEE SOLUTIONCheck out a sample Q&A here
Blurred answer
Similar questions
  • SEE MORE QUESTIONS
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:
9780134580999
Author:
Elaine N. Marieb, Katja N. Hoehn
Publisher:
PEARSON
Biology 2e
Biology 2e
Biology
ISBN:
9781947172517
Author:
Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:
OpenStax
Anatomy & Physiology
Anatomy & Physiology
Biology
ISBN:
9781259398629
Author:
McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:
Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:
9780815344322
Author:
Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:
W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:
9781260159363
Author:
Martin, Terry R., Prentice-craver, Cynthia
Publisher:
McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Inquiry Into Life (16th Edition)
Biology
ISBN:
9781260231700
Author:
Sylvia S. Mader, Michael Windelspecht
Publisher:
McGraw Hill Education
SEE MORE TEXTBOOKS